4077 " " - [cloaked tagline] !!eerreehh ssii 44..11 rreekkaaeerrFF ttxxeeTT * BCSUTI Version 1.0 *'M ST*P*D - I'd like to buy a vowel, Pat, an "O" please. *** TAGLINE BAN IN EFFECT IN THIS CONFERENCE *** ***WARNING!*** Tagline Theft Alarm Active **FLASH** Energizer bunny arrested, charged with battery. *I* didn't do it, the *computer* did it! *IT IS* documented, look under "For Internal Use Only." *_?!^%$#+\)#!~ = Klingon for "Hello, dear." ****** X iCi˻, ߳_ոS... ****** * We interrupt this tagline for a tagline. * - The Def. of Upgrade: Take old bugs out, put new ones in -!- and quietly strangled...Cocks ------------POLICE TAGLINE DO NOT CROSS------------ --T-A+G-L-I+N-E--+M-E-A+S-U-R+I-N-G+--G-A+U-G-E-+char-57^ -=( Warm, Dry, and Fed; That's Life )=- -=<( SIC GORGIAMUS ALLOS SUBJECTATUS NUNC )>=- -> <- Invisible tagline, send $10 for special -> Today is cancelled due to lack of interest! <- ... Borg spreadsheet program: Locutus 1-2-3 ... File not found. Should I fake it? (Y/N) ... Go ahead, steal my tagline. I stole yours! ... So it is Written, So Let it be Done! ... Surf naked! ...A radioactive cat has 18 half-lives...... ...and that's MY worthless opinion. ...but I forgot all about the Amnesia Conference!! ...random acts of kindness and senseless acts of beauty ...she canna take much moor Captin... ...yeah, uh, that's the ticket!..... .gnorw og... gnorw og... gnorw og nac gnihton .. i _ }{ ɻD r Sp!! .. ///\/\\\ Borg bug ///\oo/\\\ There are no more bugs. ///\oo/\\\ ///\oo/\\\ 0 bytes free 0020 * A penny saved is ridiculous. 1 + 2 = 3. Therefore 4 + 5 = 6. 1 Gig is 1,073,741,824 bytes - NOT 1,000,000,000! $1. Correct answers: $5. Dumb looks: Free! 100 Tennis is irrelevant. - Bjorn Borg 100 Who's scruffy looking. *Han* $1000 reward for finding this man:  1024x768x256.... Sounds like one MEAN woman! 186,000 miles/sec: Not just a good idea, it's the LAW. 18th pixel from left near the top of screen. 2 + 2 = 5 for extremely large values of 2. 2400 Baud makes you want to get out and push!! 26% of Canadians can't read. The other 92% can't do Math. 29A, the hexadecimal of the Beast. 3 dreaded words: hard disk failure 3 kinds of people: those who can count & those who can't 3 things occur when you age.. 1) memory goes 2) uh.. um.. 4 food groups: fast, frozen, microwaved, and junk. 43.3% of statistics are meaningless! 5 out of 4 people have trouble with fractions. "640K ought to be enough for anybody." - Bill Gates, 1981 640K should be enough for anybody - Bill Gates, 1991 666:Number of the Beast - 668:Neighbor of the Beast 7 1/2 million years and all you can come up with is 42?! 8 of 10 people suffer from hemorrhoids; 2 like e 80% success, most of the time...... 89.6% of all statistics are wrong. 90% of being smart is knowing what you're dumb at. :.::: ::..: ::.::. :..:: Tagline in Braille. <<>> <<>> "Captain, we're being hailed" ...It's WORF, not WOOF! >>> Insert Clever Tagline Here <<< >>> Pardon my driving; I'm trying to reload <<< >ov++h+n AC*hanks for hanging up, dear. A 'government subsidy' is getting just some of your own money back. A babe is an angel whose wings decrease as his legs decrease. A bachelor can only chase a girl until she catches him. A bad beginning makes for a good ending. A bad workman quarrels with his tools. A BBSer's telephone bill knows no bounds... A big enough hammer can usually fix anything. A bird in the hand is safer than one overhead. A bird in the hand is worth about three Kleenex. A blind man is no judge of colors. A blush on the face is better than a blot on the heart. A boy becomes a man when he walks around a puddle instead of through it. A brain is worth little without a tongue. A career is a job that takes about 20 more hours a week. A cat's purr is the sound of it generating cute. A centipede is an ant made to government specs. A chain is no stronger than its weakest link. A cheap shot is a terrible thing to waste. A chicken doesn't stop scratching just because the worms are scarce. A chicken is an egg's way of producing more eggs. A child of 5 could understand this! Fetch me a child of 5 A clean desk is a sign of a cluttered desk drawer. A clean, neat, desk is a sign of a sick mind. A clear conscience makes a good pillow. A closed mouth gathers no feet. A committee is a group that keeps minutes and wastes hours. A company is known by the company it employs. A conclusion is simply the place where you got tired of thinking. A consultant may be defined as an unemployed practitioner. A contented man is always rich. A contradiction of terms-The Best of Rush Limbaugh A courageous foe is better than a cowardly friend. A crappie is not a sunfish found in a toilet. A crate of UZI's, a carton of whiskey...lets go to Disneyland! A crucifix? Oy vey, have you got the wrong vampire! A cult is any religion without political power. A cynic smells flowers and looks for a casket. A day without sunshine is like night. A desk is a wastebasket with drawers. A diamond is just a lump of coal that made good under pressure. "A dirty book is rarely dusty" A dirty book is seldom dusty. A dirty mind is a wonderfully fun thing! A dragon a day, keeps the world away. A drunken man's words are a sober man's thoughts. A dyslexic agnostic doesn't believe in Dog. A fail-safe circuit will destroy others. A failure will not appear till a unit has been shipped. A false friend and a shadow stay around only while the sun shines. A fate worse than death: to be married alive. A father is a banker provided by nature. A fault recognized is half corrected. A feature is a bug with seniority. A fertile mind requires a lot of dirt. A fool always finds a greater fool to admire him. A fool and his money are my kind of customer A fool and his money are my two favorite people. A fool and his money are soon partying. A fool and his money is my kind of customer! A fool and his money share the same mattress. A fool wants to be king. A wise man wonders if he can handle the job. A friend advises in his interest, not yours. A friend in need is a pest indeed. A friend is someone who knows me and likes me anyway. A Goethe is a steel beam; a Joyce is a wooden one. A good hot dog feeds the hand that bites it. A good hug should put a smile in the heart A good name is more desireable than great riches... A good organizer is one who is careful to plan ahe. A good tree cannot bring forth evil fruit. A great idea needs landing gear, not just wings. A halo has only to fall a few centimeters to become a noose. A hangover is the wrath of grapes. A happy Klingon is a bloddy Romulan! A hundred thousand lemmings can't all be wrong. A hypocrite is one who sets good examples when he has an audience. A Jedi named ROY-onge betrayed and murdered your father. A job is nice but it interferes with my life. A joke never gains an enemy, but often loses a friend. A kind heart is of little value in chess. A kiss is a pleasant reminder that two heads are better than one. A Klingon, a Romulan, and a Borg we . A Macintosh is an EtchaSketch you don't have to shake. A man cannot spin and reel at the same time. A man may be young in years, yet old in hours. A man once claimed nothing was true; but he was lying A man should live forever, or die trying. A man wrapped up in himself makes a very small package. A man's best friend is his dogma. A man's brain is his Achilles' heel. A man's house is his hassle. A martyr is a hero who didn't make it. A masterly retreat is in itself a victory. A mistress is something between a mister and a matress A mountain is climbed a step at a time. A mouse is an elephant built by the Japanese. A nanite is a midget nanny! A nudist has no reason to fear a pickpocket. A nut that is easy to crack is often empty. A path without obstacles probably leads nowhere. A pennie earned is Cheap labor.. A penny earned....is cheap labor. A penny for your thoughts; $20 to act it out. A penny saved is a Congressional spending oversight. A person in a passion rides a mad horse. A pessimist complains about the noise when opportunity knocks. A pest: A friend in need. A picture is worth a thousand words; a slide show is both. A poor excuse is better than no excuse at all. A procrastinator's work is never done. A professional is one who does a good job even when he doesn't feel like it. A professor is one who talks in someone else's sleep. A programmer's work is never done. A reasonable man accomplishes nothing. A road map always tells you everything except how to refold it. A rolling stone gathers no moss. A royal Egyptian passing gas is a toot uncommon. A second class effort is a first class mistake. A seminar on time travel will be held two weeks ago. A single fact can spoil a good argument. A small carafe of wine is illogical, immoral, and inadequate. A small good deed is better than the grandest intention. A small leak will sink a great ship. A smile is a curve that can set a lot of things straight. A Smith & Wesson beats four aces. A social life? What board can I d/l that from? A social life? What board can I download THAT from? A spoonful of honey will catch more flies than a gallon of vinegar. A stitch in time would have confused Einstein. A successful baseball player gets a hit only once out of every three tries. A taxpayer is one who does not have to pass a Civil Service examination to work for the Government. A ten-gallon hat really holds only three-fourths of a gallon. A thick head can do as much damage as a hard heart. A thing not looked for is seldom found. A thing of shreds and zatches. A verbal contract isn't worth the paper it's printed on. A waist is a terrible thing to watch! A well-crafted tagline is a joy forever. A wise man changes his mind, a fool never. A wise man may look ridiculous in the company of fools. A wise man once said.... I don't know... A woman's advice is not worth much, but he who doesn't heed it is a fool. (A)bort, (R)epent, (I)gnorant? (A)bort, (R)etry, (G)rab a stick and kill it (A)bort, (R)etry, (I)gnore, (N)uke the CPU? (A)bort, (R)etry, (K)ick the friggin' thing? (A)bort, (R)etry, or (C)oerce with hammer. A.A.A.A.A. - An organization for drunks who drive. AAAAAA - American Association Against Acronym Abuse Anonymous AAcckk!! II''mm iinn hhaallff dduupplleexx About a half a bubble off of plumb..... Absence makes the heart go wander. Abstain from wine, women and song. Mostly song. Abstinence is a good thing if practiced in moderation!!! Abuse of power comes as no surprise. Accelerate your P.C.! (like, say... 9.8 m/s^2?) Access denied--nah nah na nah nah! Acetone = What you do in exercise class. Acid consumes 47 times its weight in excess reality. Acid Rain - Not as groovey as it sounds. Acoustic: Used to play pool. Denial: A river in Egypt. Buccaneer: The price of corn. Acoustic: What you shoot pool with. Actually, most Americans get their news from liner notes. Actually, there IS a banana in my pocket... Add a feature... Add a bug... Admit it-- you expected to see a copyright notice here. Adolescence is when children start bringing up their parents. Adolescence: the stage between puberty and adultery. Advertisement: the most truthful part of a newspaper. Advertising raises the standard of living by raising the standard of longing. Advice is free: The right answer will cost plenty. Advice: 5 And Worth Every Penny! Aern't spill chukkers grate? After all is said and done, usually more is said than done. After dinner, he said, "Your modem or mine?" After four decimal places, nobody gives a damn. Age is a high price to pay for maturity. Age isn't important unless you're a cheese. Ah know what a bagel is, but what kind of dog is a lox? Ah My Favorite!! Cream Of Spotted Owl Soup. Ah well, they say it's not as bad as they say it is...... AIBOHPHOBIA - the fear of palindromes. ainoko@downey.socal.com Air conditioned environment - Do NOT open Windows! Air pollution is a mist demeanor. Alas poor Tagline! I knew it well... ALERT! ALERT! No, wait! It's TWO lerts! Alex Haley was adopted! Alimony is having to say you're sorry once a month. Alimony is like buying oats for a dead horse. All answers questioned here. All computers wait at the same speed. All hope abandon, ye who enter messages here. All I ask for is an opportunity to prove that money doesn't buy happiness. All I did was press E-N-T-E-R, like the screen said!?!? "All life's answers are on TV" -Homer Simpson All men are created equal. It sticks out more on some. All my good tag lines are on my other computer. All people smile in the same language. All programmers want arrays! All progress stems from change but all change is not necessarily progress. All reality is aspect dependent. All requests for sick leave must be approved two weeks in advance. All rising to a great place is by a winding stair. All stressed out and no one to choke..... All that glitters has a high refractive index. All the easy problems have been solved. All the world's a stage, but most of us are stage hands. All things are difficult before they are easy. All things excellent are as difficult as they are rare. All things is made of the same thing: nothing All this significance - what does it mean? All true wisdom can be found in taglines. All true wisdom is found in taglines. All wiyht. Rho sritched mg kegtops awound? ALL-PURPOSE EXCUSE:It seemed like a good idea at the time Almost all loan officers have artificial hearts. Almost everything in life is easier to get into than out of. Almost perfect... but not quite. Alright, who's been cooking hot dogs in the warp nacelles? ALTA DATA BOX BY GERY ZUMBRUNNEN ++41/82/32131 V Although up to its neck in hot water, the tea kettle continues to sing. Always be sincere, even if you don't mean it. Always do right. This will gratify some people and astonish the rest. Always hold your head up but keep your nose at a friendly level. Always remember to pillage BEFORE you burn. Always tell the truth ..& be ready to run like h***! Always use tasteful words. You may have to eat them. Always willing to share my ignorance... Am I the only one who worked that out??? :) Amazon Martian SysOps are the BEST!!!! AMIGA is the best! Hey, whatz that... A gun.. AAAH. BUM! An appeaser is one who feeds a crocodile - hoping it will eat him last. An Armed Citizenry *IS* the Militia An atheist is a man with no invisible means of support. An authority knows lots of things you don't care about. An elephant is a mouse built to government specifications. An elephant is a mouse built to Mil-spec. An elephant is a mouse with an operating system. An engineer is someone who does list processing in Fortran. A masochist is anybody who does anything in COBOL... An expert has a great reason for guessing wrong. An expert is someone from out of town. An extra tire in de trunk. An improper mind is a perpetual feast. An object of information most needed will be least available. An open mind doesn't always require an open mouth An optimist is a person without much experience. An optimist laughs to forget..A pessimist forgets to laugh. An ounce of application is worth a ton of abstraction. An ounce of image is worth a pound of performance. An unbreakable toy is excellent for breaking other toys. Anarchist of the world, Unite! Anarchists unite. Anarchy is against the law. Anarchy is better than no government at all. And Adam asked, "What's a headache?" And all the children are above average in our system. And maybe we'll do in a squirrel or two. And now for something completely different... And now, a word from our sponsor... And on the 8th Day God said, "Murphy, you're in charge." And that is what I think... nyeh nyeh nyeh! And the celery stalked out of the kitchen... And the Dollar is holding steady at 100 cents And the only thing the Borg left was this Amiga ... And then Adam said, "What's a headache?" And then the Nun said "No, give me the banana!" And they shall plow their swords into beach chairs. And this, Wesley, is an airlock. "And this, Wesley, is an airlock." And thus ends another wit-filled message. And to all you unevolved liforms BANG the rocks together. ANDERSON Mental Care: We care, because we've been there. Angels fly because they take themselves lightly. Chesterton. Anger is a wind which blows out the lamp of the mind. Anger is never without reason, but seldom with a good one. Another day, another buck 2.98 minus tax..... Another smooth escape disguised as a dramatic exit. Answers: $1, Short: $5, Correct: $25, dumb looks are still free. Any IC protected by a fast acting fuse will protect the fuse by blowing first. Any sufficiently advanced bug will become a feature. Any sufficiently advanced technology is indistinguishable from magic. Anybody can be born right-handed. Only the best of us overcome it. Anybody can win, unless there is a second entry. Anybody with money to burn will easily find someone to tend the fire. "Anyone care for a jellybaby?" Anyone for fishing?....no time got to read.. Anything dropped in the bathroom falls in the toilet. Anything not nailed down is a cat toy. Anything that can go wrong will. Anything we learn today may be disproven tomorrow. Anything worth doing is worth overdoing. Apathists of the world ..... ahh, forget it! Apathy Error: Don't bother striking any key. "Apple" (c) Copyright 1767, Sir Isaac Newton. Appreciate me now - and avoid the rush. Archaeologists take sedimental journeys. Archaeologists will date any old thing. Are dog biscuits made from collie flour? Are Girl Scout Cookies made from real Girl Scouts? Are the lambs still screaming??? Are the noises in my head bothering you? Are you being Served"... Are you illiterate? Write to us for a free book. Are you out of your Vulcan mind?!? Are you suggesting coconuts are migratory? Are you sure (Y/Y)? Aren't spill chukkers grate. ARIZONA's LARGEST PCBoard - 8 HST/v32b Nodes Armadillo: Possum on the half-shell. Armaments, Chapter Two, Verses Nine to Twenty-One. Army food: the spoils of war. Arrogance is the obstruction of wisdom. Art, like morality, consists of drawing the line somewhere. Artificial Intelligence is no match for natural stupidity Artificial Intelligence: The other guy's opinion. Artoo, fire up the converters. * Luke As easy as 3.1415926535897932384626433832795028841 As I said before, I never repeat myself. As scarce as the truth is, the supply is much greater than the demand. ASCII and ye shall receive. ASCII stupid question, get a stupid ANSI! ASCII to a ASCII, DOS to DOS. Ask me about my vow of silence. Asking dumb questions is easier than correcting dumb mistakes. Asking if computers can think is like asking if submarines can swim. Assassins Do It Secretively, and Finally Assume the worst, you'll never be disappointed. Assumption is the mother of all screwups. Astronauts are out to launch. Astronauts get missile-toe. At the end of the game, the king and the pawn go into the same bag. At what point in the dairy process is the Milk Dud made Atheism is a non-prophet organization. Atheist Problem #6: No one to call out to during sex. Atheist: A man with no invisible means of support. Ather be a live namby-pamby than a dead executive." - Bud Athletes do it on the run ATTENTION.... Elvis has left the echo. Attitude adjustments $29.95. Alignment extra. Aunt Em: Hate Kansas. Hate you. Took dog. Dorothy Authority tends to assign jobs to those least able to do them. Avoid criticism - say, do and be nothing. Avoid reality at all costs. Avoid run-on sentences they are hard to read Avoid the 5 o'clock rush - always leave work at noon. Aw Honey... just one more message, honest... Babies are god's opinion that the world should go on. Baby stork, "Mama, where did I come from?" Back Up My Hard Drive? I Can't Find The Reverse Switch! Backup not found: (A)bort (R)etry (P)anic Backup! He's got a magnet!!! Bacon & eggs - Hens are involved but pigs are commited. Bacteria, n.: the only culture some people have. Bad Case #12: Nostalgia buff with amnesia. Bad command or file name! Go stand in the corner. Bad Command:(A)bort (R)etry (T)ake RAM hostage Bad dog! Don't chew the power cor..!# NO TERRIER Bad luck is being run over by the welcome wagon. Bad officials are elected by good citizens who do not vote. Bad weather reports are more often right than good ones. Bald spot? No -- solar panel for brain power. Barfigngen: Car Sickness in a Volkswagen. Bark! Bark!...and you stay out of mine - Beverly Barney is a velociraptor. Basic Airline Flying-Keep the pointy end forward.. Basic is a high level languish. Bathroom scale: Something you stand on and swear at. batlh Daqawlu'taH Batteries not included. Battle Creek makes cereal terminals. Baudy house: A bordello with a modem... BBS addiction is a terminal disease. BBS: a method to triple your phone bill. Be a better psychiatrist and the world will beat a psychopath to your door. Be a boss so you, too, can work 16 hours a day* Be Alert! - the world needs more Lerts. Be alert, america needs more lerts. Be as you would seem to be. Be bold, and mighty forces will come to your aid. Be consistent - but don't do it all the time. Be good to your environment -- purge your tree. Be kind. Remember everyone you meet is fighting a hard battle. Be nice to your kids. They will choose your nursing home. Be part of the solution, not part of the pollution. Be patient... God isn't finished with me yet! Be sure the brain is engaged before putting the mouth in gear. Be virtuous and you will be eccentric. Beam me up Scotty - - no, Scotty that's not what I meant Beam me up Scotty! The liberals have taken over! Beam Me Up Scotty, ............*S-C-O-T-T-Y*!!! Beam me up, Scotty! It ate my phaser. Beat me, whip me, make me read my mail online. Beaten paths are for beaten men. Beauty without virtue is a curse. Become a millionaire, send $1.00 for details... Beep! Invalid Input. I take only cash.... Beer. It's not just for breakfast anymore! Before borrowing money from a friend, decide which one you need more. Before you meet any handsome price, you have to kiss a lot of toads. Behind every successful man - a surprised mother-in-law. Behind every successful man is a woman who made it necessary. Behind every successful woman - herself. Being a viking, I eat raw software Best Regards From The Good Folks At Trio+ Software Beta Testers do it first! Beta version - too buggy to be released. Better or worse, but never the same. Better than counting your years is making all your years count. Better the foot slip than the tongue. Better to face a danger once than be always in fear. Better to light one candle than to curse the darkness. Beverly can turn Data off but only Tasha can turn him on Beverly, Tasha and Deanna: A Menag a Trois? Beware of a half truth; you may be getting the wrong half. Beware of dark rooms ... They might be the morgue. Beware of little expenses. A small leak can sink a ship. Beware of programmers who carry screwdrivers. Bible is copyrighted by God. Bigamy: one wife too many. Monogamy: see Bigamy. Bigamy: Too many wives. Monogamy: Same thing. Bikinis - my favourite aphrodisiac. Bill Clinton tax form --> Send us all your money Bill Clinton's not like Jimmy Carter ... more like Billy. Bill Gates, have 'em write _real_ code... Bill Gates: For whom the belle toils! :) BIO-GENETIX LABS: "Playing God so you don't have to. Bioengineers wear designer genes. Biology grows on you. (bits of ice striking hull) "Captain, we're being hailed." Black holes are where God divided by zero. Blame St. Andreas - it's his fault. Blessed are the brief for they will be invited again. Blessed are the inept for they shall inherit the skies. Blessed are the meek, for they make great scapegoats. Blessed be The Goddess and The God. Blessed is he who expects nothing, for he shall never be disappointed. bljeghbe'chugh vaj blHegh Blonde Klingons: because it was a good day to dye. Blood is thicker than water. Tastier and more nutritious too. BOING! ASCII stupid question; get a stupid ANSI. BOING! Tickling the phosphors on your screen Bombs don't kill people, explosions kill people. Bones, I hate your #@!*% human guts. Discussion? "Bones, I'm a captain, not a doctor." -Kirk Boot & ye shall see. Replace & all will be made clear. Bordello with a modem: A "baudy house" Borg Mail Reader v2.1a * Tagline theft is futile. Born free..Taxed to Death! Bosses are so busy delegating jobs, they have no time to work. "Bother" said Pooh, and deleted the entire message base "Bother," said Pooh, as he saw the mushroom cloud. Bought some powdered water..not sure what to add, though. "Bourbon & beans...an explosive combination." Kirk Boy Am I Tired! It Must Be The NET-LAG! Boy: A noise with dirt on it. Boycott meat - suck your thumb. Boycott shampoo! Demand the REAL poo! Bragging? Sir? Brain damage? No thanks, I already have some. Brain damage? No thanks, I already have some. BRAIN.COM file closed. (A)rgue (R)etry (F)orget It Brain: an apparatus with which we think we think. Brandy-and-water spoils two good things BREAKFAST.COM halted... cereal port not responding! BREAKFAST.COM Halted...Cereal Port Not Responding. Breeding rabbits is a hare raising experience. Brevity is the soul of wit. Bride: a woman with a fine prospect of happiness behind her. Brig C. McCoy - Soft-tek International, Inc. - Wichita+ Bring order to your life, use random numbers. BTN: Articles, tech reviews, editorials and Martian fish. BTN: Birmingham Telecommunications News. Now you know. BTN: New things, new opinions, new punches to the nose. BTN: The world's most open article submission policy. BTW, FWIW, IMHO, yes. OTOH, AAMOF, maybe not. Buddhist ordering pizza: "Make me one with everything." Buddy, can you spare some cache? Budget: an orderly system of living beyond your means. Build a system that even a fool can use and only a fool will want to use it. Build something foolproof and every fool will use it. Bureaucracy: a method for transforming energy into solid waste. Bureaucrats are the meat loaf of humanity. Burma Shave signs for off-line readers Burroughs programmers have to pay a Poll tax. Bushydo: the way of the shrub. Busier than a one-eyed cat watching 9 mouseholes But Bullwinkle, that trick NEVER works! But I thought YOU did the backups... But I wanna get my mail packet, I wanna, I wanna,I wanna! But soft, what bird through yonder window breaks? But soft, what light through yonder tagline breaks? But what if I'm a figment of MY imagination? But who is beta-testing the users? But why do you exist...here? But you can't let her drive! She's legally blonde! But you thaid is was a pith helmet! Buy in haste, repair at leisure. Buy one, get one free? Does it have to be in that order? By Grace Are Ye Saved, Through Faith..Eph2:8 By the time a man reads women like a book he's too old to collect a library. By the time you get to where you can make ends meet, someone moves the ends. By the time you realize what love can do, the damage has already been done. By: Trial and re-boot C code. C code run. Run code, run. C Error #009: FATAL! Portable code found C is for Bangers. C programmers do it in a structured manner. C'est la vie, Jim, but not as we know it. C++ programmers do it with class. C-ing is believing C:\BELFRY is where I keep my .BAT files. C:\CLINTON\TRUTH.COM not found. Abort, Retry, Impeach? C:\DOS C:\DOS\RUN RUN\DOS\RUN CA bumper sticker: Cover me, I'm changing lanes. Cajun breakfast: Blackened toast California does have its faults. Call me apathetic ---- I don't care! Call me Ishmael. I won't ANSWER, but... Calling from N.W. Wisconsin Calm down! It's only zeros and ones. Camelot! .....It's only a model. Can I go back to bed now? Can I yell "movie" in a crowded firehouse?? Can you remember when the air was clean and sex was dirty? Can you tell I need more tag lines? Can't underestimate the power of fear. Cap'n, I threw your stinkin palm tree overboard! Capital Punishment means never having to say "you again?" Capt'n! The spellchecker kinna take this abuse! Capt'n....there be whales here!!!!!! Scotty Captain Kirk is a weenie. "Captain Picard, I have a clever plan!" - Ensign Baldrick Captain please, not in front of the Klingons. Captain! The spell checker kinna take this abuse! Captain! The UARTs kenna' take these speeds! Captain, I beleive it is time for a colorful metaphor. "Captain, I sense a million minds staring at my cleavage." Captain, we have attained ridiculous speed. * Data Captain, why do you have floor wax in here? "Captain, why not just give the Borg Windows 3.1?" - Worf Captain... your head! You're growing HAIR!!! Careful planning will never replace dumb luck. Careful!!...You may be the only Bible some people ever read. Carelessness does more harm than a want of knowledge. Carpenters are just plane folks. Castration takes balls. Cat + unattended keyboard = garbage all over screen Cat bathing is a martial art. Cats. Earths most purrfect lifeform. Cauliflower is nothing but cabbage with a college education. !CAUTION! Taglines may be hazardous to your disk space! Caution: Humorous tagline under construction. Caution: Slow Children at Play! CCITT - Can't Conceive Intelligent Thoughts Today CCITT- Can't Conceive Intelligent Thoughts Today Celibacy is not hereditary. Censor - a man who knows more than he thinks you should. Cereal Killer Strikes Again! Cap'n Crunch found dead... Certe, Toto, sentio nos in Kansate non iam adesse. cf. Alma's "Meine Leibeswerbung mit Darryl Basner." Chain Tagline! Copy or bad luck will follow! Character is not made in a crisis - it is only exhibited. Charlie was a chemist, but Charlie is no more. What Charlie thought was H2O was H2SO4. Chaste makes waste. Chemistry professors never die, they just fail to react. Chemistry professors never die, they just smell that way! Cheops' Law: Nothing ever gets built on schedule or within budget. Chicken - the egg's way of making more eggs. Chicken heads are the chief food of captive alligators. Chicken Little only has to be right once. Childish game: one at which your spouse beats you. Children need love, especially when they don't deserve it. Choose Heaven for climate, Hell for society. Choosy modemers choose GIF Christ died for our sins, so let's not disappoint him. Christmas on other planets, when Mondovideo continues. Christmas time is here to stay - so they say! Circular Definition: see Definition, Circular. Civil servants are neither civil nor servile. Civilization is a race between education and catastrophe. Classified ad: For Sale: Man's suit, perfect fit...... Classified tagline==Please enter password._ Cleverness is serviceable for everything but sufficient for nothing. Click ... click ... click ... damn, out of taglines! Climate is what you expect. Weather is what you get. Clinton didn't inhale . . . Brown didn't exhale! Clinton promises changes and changes promises Clinton's Navy gives new meaning to, "going to the head!" Clinton's not a crook; He's "ethically challenged." Clones are people two. Cloning is the sincerest form of flattery. CLOP ON, CLOP OFF, THE CLOPPER Clothes make the man; naked people have little or no influence on society. Cluttered desk = cluttered mind / empty desk = empty ______? Cobol programmers are down in the dumps. COBOL programs are an exercise in Artificial Inelegance. Cogito, ergo Hormel - I think, therefore I Spam. COLE's LAW - Thinly sliced cabbage. Color is only a pigment of your imagination. Columbus had a fourth ship - it sailed over the edge. COM program murdered. "Bits everywhere" says witness. Come in, Beverly, and I'll show you a real Picard maneuver. Coming Soon!! Mouse Support for Edlin!! Coming soon: EDLIN for Windows and OS/2 Coming soon: Netware for Nintendo Coming to a TV soon, "Days of Our Modems" Command Interpreter Bad or Missing... Commander, I'm getting excited again... * Bashir Common sense is instinct, and enough of it is genius. Common sense is the least common of all senses. {COMMO} + DESQview + '486 = Happy Camper Communism is like one big phone company. Comp Scis have bigger hard disks. Compassion is the basis of all morality. Compile, run, curse. Recompile, rerun, recurse. Computer Engineers do it bit by bit. Computer illiteracy? You mean my computer's supposed to READ? Computer programmers never die, they compile Computer programmers never die, they just get lost in the processing. Computer spelled MOST ways is AAAARRRGGGHHHH!! Computers are unreliable, but humans are even more unreliable. Computers can never replace human stupidity. Conan! watch out for the quicksa NO WARRIOR Conceit is a pain killer for stupidity..... Conceit is God's gift to little men. Confession is good for the soul, but bad for the career. Confucious say too damn much! Confucius Say: Better to close mouth and appear stupid than to open mouth and remove all doubt. Confused Now? -- Try EdLin With Deluxe . . . Confused? Call Counselor Troi 1-900-NCC-1701: $1.95/min Confused? Counselor Troi. 1-900-NCC-1701. $1.95/minuite. Congress, The royal family of the U.S. (DeadBeat CONGRESS.SYS corrupted! reformat WASH.DC ? Conservative (n): Liberal who has been mugged. Consistency is the hobgoblin of small minds. Consistency is the last refuge of the unimaginative. Constant change is here to stay. Constants aren't; variables don't. CONSULTANT: Person who makes good on salesman's promises! Contents may have settled out of court. Contentsoftaglinemaysettleduringshipping. COOK found - (B)urger King (M)cDonalds (T)aco Bell Cooperation is doing with a smile that which you have to do anyway. Copy from another: plagiarism. Copy from many: research. Could you be a little more vague, counselor? "Could you continue your petty bickering? I find it most intriguing." Could you state that as a question, please? Counting in binary is just like counting in decimal, if you are all thumbs. Counting in octal is just like counting in decimal, if you don't use your thumbs. Courage is fear that said its prayers. Courage isn't having the strength to go on - it's going on when you don't have the strength. Courtesy distinguishes humans from animals. Courtesy on one side can never last long. CP [NR] * "If it screams, it's best not to eat it." CP [NR] * I am become Vishnu, destroyer of taglines. CPE1704TKS "The only winning move is not to play." - Joshua Cream rises to the top... but then so does scum. Creditors have better memories than debtors. Crime wouldn't pay if the government ran it. Crime, Sex, Alcohol, Drugs... God, I love Congress. Crime, Sex, Alcohol, Drugs... God, I love Washington, D.C. 'Criminal Lawyer' is a redundancy. CRS Online Subscriber Crusoe got everything done by Friday. Can you? "Cry on someone else's shoulder, I'm off-duty." * Troi Crystal balls aren't really very productive. CTHULHU in 96! Why settle for the Lesser Evil! Cthulhu saves -- in case he's hungry later! Cultivate happiness and it becomes a habit. Curiosity kills more mice than cats. Curious how naked death is less obscene than naked women. 'Curiouser and curiouser,' said Alice. Customer "I would like to try on that suit in the window". Salesman "Sorry sir, you will have to use the dressing room" Cut life support to all quarters with children. * Picard Cut my pizza into six pieces please. I can't eat eight. Cutting remarks don't cut any ice. Cynicism is but idealism gone sour in the face of frustration. (D)inner not ready: (A)bort, (R)etry, (P)izza? D.A.M.N. = Naked Mothers Against Dyslexia. Damit Jim, I'm a doctor, not a bricklayer! Dammit Jim, I'm a butcher not a tagline technican. Dammit Jim, I'm a TV Character, not a tagline! "Dammit Jim, she's dead! Get off her!" -- McCoy Damn it Bill, I'm an actor, not a doctor... Damn it, Jim! I'm a doctor, not a tagline writer. Dan Quayle's library burned...both books destroyed. Dances With Wolves - the theme of our senior prom. DANGER DANGER Computer store ahead...hide wallet. Danger Will Robinson...that can make your palms grow hair Danger! Human at keyboard! Dangerous exercise - jumping to conclusions. Darmok and Groucho, at the opera. Darn, I can't think of a Tagline, Oh well. Darth Vader Lives; he recently told me so! DATA COMPRESSION: What you get when you squish an android Data's arm Tattoo ޺۳ݳݳ "Data, I thought you were dead!" "No, Sir. I rebooted!" Dave and his DOGS, going out to chase KATS "Dave, I have a projected failure on the alpha-echo three five unit within 72 hours..." Dawn crept across the lawn, searching for her car keys. Dawn: the time when men of reason go to bed. Dax just another slug with a pretty face. . . DCE seeks DTE for mutual exchange of data. De omnibus est dubitandum Dead musicians decompose Deanna, I've got a new holodeck program... * Barclay Death is God's way of telling you that you're fired. Death is Nature's way of recycling human beings. Death is nature's way of telling you to slow down. Death is when God drops carrier on you. Death MAY ease tension, researchers report. Death To All Tyrants Death to fleas that prey upon the lifeblood of my cats! Death: to stop sinning suddenly DEBUG - Takes bugs off the windshield with minimum fuss. Dedicated to the brave men who go down to the chips in C. Deeeep ka-ka! > Al Calavicci DEFINITION: Address - Type of attire worn by some female programmers. DEFINITION: Algol - The husband of Polygol, their missing daughter is Polygon. DEFINITION: Altair - A place where computers are sacrificed. DEFINITION: Array - A blast from a CRT. DEFINITION: Backup - Opposite of forward. DEFINITION: BASIC- Beginner's All-purpose Sloppy Instruction Code. DEFINITION: Bit - The increment by which programmers slowly go mad. DEFINITION: Branch - A stick used for beating. DEFINITION: Buffer - A programmer who works in the nude. DEFINITION: Chaining - A method of attaching programmers to desks to speed up output. DEFINITION: COBOL- Confused Oriental Bean-cOunting Language. DEFINITION: Coding - An addictive drug. DEFINITION: Computer - A device designed to speed and automate errors. DEFINITION: Core Storage - A receptacle for the center section of apples. DEFINITION: Cp/m - Program listing for 'Look in the evening section'. DEFINITION: Cpu - C3po's mother. DEFINITION: Dip - Inventor of a famous switch. DEFINITION: Disassembler - An unattended five year old child. DEFINITION: Disk Drive - A motor for a frisbee. DEFINITION: Duplex - Having two apartments. DEFINITION: External Storage - A wastebasket. DEFINITION: Fixed Word Length - Four-letter words used by programmers in a state of confusion. DEFINITION: Floating Control - A characteristic exhibited when you have to go to the restroom but cannot leave the computer. DEFINITION: Flow Chart - A graphic representation of the fastest route to the restroom. DEFINITION: Forth - One of the top five computer languages. DEFINITION: FORTRAN- Formless Translations. DEFINITION: GiGo - Garbage in garbage out. DEFINITION: IBM - Computer company: "Itty-Bitty Machines" Corporation. DEFINITION: IBM - Corporate motto: "I've been moved." DEFINITION: IC - Understanding as in 'Oh, IC'. DEFINITION: Initialize - Carving your initials on a floppy disk. DEFINITION: Input - Food, beverages, painkillers, stimulants, etc. DEFINITION: Iterate- A healthy illiterate. DEFINITION: Joystick- A peripheral intended for use only by consenting adults. DEFINITION: Keyboard- Resembling a typewriter, a keyboard is used for entering errors into the computer. DEFINITION: Kilo - What you could have spent your money on if you hadn't bought the computer. DEFINITION: Language- A system of organizing and defining syntax errors. DEFINITION: Macro - The last half of an expression of surprise: "Holy Macro". DEFINITION: Math Chip- A piece of a broken abacus. DEFINITION: Megabyte- A nine course dinner. DEFINITION: Memory Map - A sheet of paper showing location of computer store. DEFINITION: Mhz- Acronym for 'Megahurtz', meaning 'a million pains'. DEFINITION: Microfiche - Sardines. DEFINITION: Nanosecond - Mork's stunt man. DEFINITION: Newdos - Acronym for 'Not Exactly What The Dealer Offers To sell you. DEFINITION: Password- The nonsense word taped to the CRT. DEFINITION: Upgrade - Take old bugs out, put new ones in. Delay is the deadliest form of denial. Democracy: Four wolves and a lamb voting on lunch. Despair: an extra tire in de trunk. Despite the cost of living, it remains popular. Despite the high cost of living, it remains popular. Desqview vs. Windows is a no-Win situation. DESQview: Windex for Windows DeVry: We're Serious About Our OWN Success! Diarrhea is hereditary. It runs in your jeans. 'Did ya put the cat out?' 'I didn't know it was burning' Did you expect mere proof to sway my opinion? Did you know that clones never use mirrors? Didja ever stop to think and forget to start again Didn't see it, don't have the T-shirt. --M. Hahn Diets are for people who are thick and tired of it. Difference between a house and a home - a family. Difference between tax avoiding and evasion is 10 Years. Difficult? I wish it had been impossible! Difficulty is the excuse history never accepts. Digital circuits are made from analog parts. Dijon vu: the feeling you've tasted this mustard before. Dime: A dollar with all the taxes taken out. Din't mean to?! You put your sword right thru his head! Dinner Not Ready...(A)bort (R)etry (P)izza Diplomacy - the art of letting someone have your way. Diplomacy is the art of saying 'Nice doggie!' till you can find a rock. Disco is to music what Etch-A-Sketch is to art. Discover all unpredictable errors before they occur. Discoveries are made by not following instructions. Disinformation is not as good as datinformation. Disk error: (A)bort (R)etry (N)egotiate release of disk? "DISK FULL?" DisneyLand: A people trap operated by a mouse. DO : PRINT "Waiter, There's a bug in my..." : LOOP Do agnostics really say, 'Oh, bother' when their planes go down? Do files get embarrassed when they get unzipped? Do it today, tomorrow it will be bad for your health or illegal. Do not adjust your mind, the fault is with reality. Do not attempt to traverse a chasm in two leaps... Do not believe in miracles - rely upon them. Do not curse the darkness, check your warranty. Do NOT push that red button over there. Do not remove this tagline under penalty of law. Do not take life too seriously; you will never get out of it alive. Do radioactive cats have 18 half-lives? Do ROFLS have ridges? Do unto others as they should do unto you but won't. Do unto others as though you were the other. Do unto others before they undo you. Do what you will with this tagline, just don't bother me about it! Do you always hit the nail right on the thumb? Do you have Bernoulli sauce in this restaurant? Do you like me for my brain or my baud? "Do you mind? I'm eating my cereal!" - Picard Do you prefer gin and platonic or scotch and sofa? Do your knees buckle, but not your belt? Docs? Why would I want to look at the Docs. Nurses are better :) Does "Bad FAT" mean disk has high cholesterol? Does "Forsaking All Others" mean I can't date? Does anybody really read these things? Does anyone REALLY read these stupid taglines? Does fuzzy logic tickle? Does killing time damage eternity? Does steel wool come from metal sheep? Does the Enterprise printer use a Queue Continuum? Does the name Pavlov ring a bell? (Does this look like a fraction to you?) OS/2: Where's the other half?! T. Peters. Does your back go out more than you do? Doesn't EVERYBODY wear straightjackets? Dogs come when you call. Cats have answering machines. Doing nothing makes you tired 'cause you can't take a break. Don't argue with he who uploades REPs by the megabyte. Don't ask me; I was hired for my looks. Don't assume malice for what stupidity can explain. Don't be mad about growing old, some aren't that lucky. Don't be sexist. Broads hate that. Don't be so open-minded your brains fall out. Don't believe anything you hear or anything you say. Don't blame me - I voted for Perot! Don't blame me, I voted for Bush. Don't call me Samuel! don't care if I am a lemming, I'm not going! Don't count your upgrades before they're patched! Don't ever stand up to be counted or someone will take your seat. Don't force it, get a larger hammer. Don't get discouraged...No one is perfickt. Don't hate yourself in the morning - sleep until noon. Don't insult the alligator till after you cross the river. Don't judge a book by its movie. Don't knock President Fillmore - he kept us out of Vietnam. Don't know what apathy is and don't care.... Don't laugh - it's got warp capability! Don't let school interfere with your education. Don't look at ME! I voted for Bush!! Don't look back. Something might be gaining on you. Don't look now, but your file is unzipped. Don't marry for money; you can borrow it cheaper. Don't misunderstand; I like kids. BOILED!! Don't panic...you have your towel, right? Don't play stupid with me, I'm better at it! Don't put all your EXE's in one backup! Don't question authority..... It hasn't got a clue!!!!! Don't quit until you find someone to blame. DON'T read the manual! Just WING that sucker! Don't Start Any Trouble, And There Won't Be Any! Don't start with me. You know how I get. Don't steal! The government hates the competition. Don't take life too seriously, it's not permanent. Don't take life too seriously, you'll NEVER get out alive Don't talk to me until I've had my second cup of coffee Don't tell any big lies today. Small ones can be just as effective. Don't touch it! It's the history eraser button you fool! Don't use a big word where a diminutive one will suffice. Don't use no double negatives. Don't use our trashcan, it's only for apples! Don't wait for the translation...answer me now! Gen.Chang Don't walk through the screen door, you might strain yourself. Don't waste the whole day, laugh at least once. Don't wear earmuffs in a land of rattlesnakes. Don't work too hard- Clinton will tax all the overtime. "Don't worry, be happy, Dawson" - Bobby McFerrin * Don't worry, I'm fluent in wierdo. Don't worry, I'm gong t bckup td! Don't worry, we can use the transporter. Don't worry: the answer's at the back of the book. Don't you just hate it when they verbify nouns? DONTREADTHISUNLESSYOUWANTTOWEARGLASSESOK "DOOH!!!" - Homer Simpson DOS never says "EXCELLENT command or filename"... DOS Tip #17: Add DEVICE=FNGRCROS.SYS to CONFIG.SYS DOS to DOS, disk to disk, file to file. DOS=HIGH? I knew it was on something... Double your drive space! Delete Windows! Dr who? Dr. Kevorkian expects full payment before your visit. "Dr. Scott!" "Janet!" "Brad!" "Rocky!" "YO ADRIAN!" Dragonslayer needed. Immediate position available. Dreams of war, dreams of liars, dreams of dragon's fire. Drilling for oil is boring. Drive A: format failed, formatting C: instead. Drive C: Error, (A)bort (R)etry (I)gnore (K)ick (S)cre+ Drive C: Error, (A)bort (R)etry (I)gnore (K)ick (S)cream? Drive carefully, death is so permanent. Drive defensively -- buy a tank. Drive not ready E: (R)etry (G)o to Impulse (C)all Geordi Drive with caution...SLICKonomics just ahead. Driving Lesson One: Shiny side up; rubber side down. Drop the vase and it will become a Ming of the past. Drop your CARRIER - we have got you surrounded!!! Drunk Borg:"Rsilience in floor tile. Wan'be similated?" Drunk is feeling sophisticated when you can't say it. Due to Budget Constraints light at end of tunnel is off! Dumb luck beats sound planning every time. Trust me. Dyslexia: it can warn without striking! Dyslexics of the world- UNTIE! E Pluribus Modem E-mail returned to sender -- insufficient voltage. E=mc^2 Very good, Albert. Next time show your work. Each day the world turns over on someone who was just sitting on top of it. Each day we are confronted with insurmountable opportunities. Eagles fly, but weasels don't get sucked into jet engines. Eagles may fly but weasels aren't sucked into jets. Eagles may soar, but weasels aren't sucked into jets! EAGLES May Soar,But Weasles Arn't Sucked Into Jets Early to bed - makes you healthy, wealthy and boring. Early to bed, early to rise, work like hell, and advertise. Earn cash in your spare time - blackmail your friends. Earth is 98% full...please delete anyone you can. Earth was not earth before her sons appeared. Eat at Tippin's Eat prune yogurt for that "get up and go" feeling. Eat well, exercise, and die anyway. Eat yogurt and get culture. Eating an anchovy is like eating an eyebrow. Echo y|DEL C:\*.* Ecky Ecky Ecky pTANG Bing whing prrn zhrrn-wup (Ni!) Editing is a rewording activity. EDLIN doesn't have a bug...EDLIN _IS_ a bug. Education means developing the mind, not stuffing the memory. Efficiency is the ability to do a job well plus the desire to do it better. Efficiency takes time! Frugality: who can afford it? Egad! I can *feel* my mind boggling... Ego: Something which enables people to bear living with themselves. Egotist: a person of low taste. more interested in himself than me. Einstein has "I before E" wrong in his own name, twice! Either he is dead, or my watch has stopped. Either this man is dead or my watch has stopped El trabajo bien hecho no tiene fronteras .... Electric chairs are period furniture; they end a sentence. Electricians are qualified to remove anyone's shorts! Elevators smell different to midgets. Eliashim's ViruSafe was distributed with Michelangelo. EMail replies to nate.lipsen@execnet.com "Energize!" said Picard and the pink bunny appeared... ENERGIZE, said Picard, and a pink bunny appeared Engineers do it precisely. Technicians do it a lot. !enif tsuj si gnihtyrevE "Ensgin Expendable, step on that rock!" - Kirk "Ensign Crusher, here is you Mop and Bucket" Ensign Pillsbury? He's BREAD, Jim! Ensign Smith, why are you standing Behind Me? Ensign Walnut approaches Dr. Crusher with caution. Ensign, engage warp drive. Ensign? ENSIGN, WAKE UP! Ensign,engage warp drive. Ensign,ensign? ENSIGN, WAKE + Entropy isn't what it used to be. Error 005: Windows loading. Come back tomorrow. Error 216: Tagline out of paper. ERROR 23AF: Sector not found; Search behind couch? ERROR 6F35: Enter any 12-digit prime number to continue. ERROR 75FF: MSDOS.SYS not found. Buy UNIX? ERROR 864F: (A)bort (R)etry (I)nfluence With Large Hammer Error failed! Press any key to resume error. Error locating MAFIA.EXE - program not executed. Error opening CLINTON.LIE Cannot recover COUNTRY.USA Error reading FAT record. Try the SKINNY one? (Y/N) Error Reading REALITY.SYS ... Universe Halted Error: (A)bort (R)etry (S)ell it Error: Keyboard not attached. Press F1 to continue. ERROR: Unable to come up with a good tagline. ERROR: Unable to come up with a new tagline ERROR@34421 TAGLINE MISSING, PLEASE BLAME SYSOP. Eschew obfuscation Eschew Obfuscation! Eternity is . . . a Barry Manilow concert. Ethernet (n): something used to catch the etherbunny Eval Day 856 * What a dead beat! Evangelists do more than lay people. "Even historians fail to learn from history." -John Gill Even if you win the rat race, you're still a rat. Even paranoids have enemies. Even the best of friends cannot attend each other's funeral. Ever feel like you're not really wanted? * Geordi Ever just seem to not be able to get around to procrastinating? Ever notice that Legos aren't biodegradable ? Ever stop to think and then forget to start again? Ever stop to think, and forget to start again? Ever think about the fact that thorn bushes have roses? Ever wish you had a copy of tomorrow's newspaper? EverReady bunny arrested, charged with battery! Every interesting program has at least one variable, one branch, and one loop.......... And at least one bug! Every little BYTE helps. Every man has a scheme that absolutely won't work. Every man thinks his own burden the heaviest. Every man's work is a portrait of himself. Every minute you are angry wastes 60 happy seconds. Every silver lining has a dark cloud. Every solution breeds new problems. Every time I lose weight, it finds me again. Everybody remember where we parked. Kirk STIV Everybody wants to go to Heaven, but nobody wants to die. Everyone has a photographic memory, some don't have film. Everyone hates me because I'm paranoid. Everyone is entitled to my opinion. Everyone needs a place in the sun, especially when it rains. Everyone serves a purpose in life, even if it is to be a horrible example. Everyone who got where he is had to start where he was Everything alive either grows or dies. Everything coming your way? You're in the wrong lane! Everything goes on sale ... right after you buy it. Everything going good? You must have overlooked something. Everything hurts ... and what doesn't don't work. Everything that is not mandatory is forbidden. Everywhere is walking distance, if you have the time. Evidence of evil Borg plot: MSDOS 6.0 Evil won't kill us; apathy & lethargy will Examine the contents, not the bottle. Excellent time become a missing person. Excuse me for butting in. But, I'm interrupt-driven. Excuse me, but do you have change for a carp? Excuse me, but is this my 15 minutes? Excuse me, can you spare a tagline? Excuse me, I have to recharge my flamethrower. "Excuse me. What does god need with a starship?" -Kirk Experience is something you don't get, 'til you need it most. Experience is the comb life gives you after you're bald. Experience is what you get when you didn't get what you wanted. Experience should be a guide post, but not a hitching post. Experience varies directly with equipment ruined. Expert - anyone from out of town. Expert - knows tomorrow why today's prediction failed. Expert- an x is an unknown, a spurt is a drip under pressure, so an expert is some unknown drip under pressure. Extrusion, Science, Art, and luck Eye of newt, toe of frog, and a side of fries, please. EZ 2.0: 5 years in the waiting, um, making. EZ come ... EZ go SLMR come... SLMR stays! "Ezz beeg trouble for Grant and kids..." -Jurassic Bori F u cn rd ths u mst b n nglsh tchr! "Fac meam diem. -- Clintus Estvoodicus" Fact - red lights always last longer than green ones. FACT: A conservative will blink when struck with a hammer "Facts are stupid things" - Ronald Reagan Failure is never fatal and success is never final. Failure to plan on your part does not constitute an emergency on my part. Faith cometh by hearing and hearing from the Word of God Faith is the bird that sings while it is still dark. Fame is a magnifying glass. Familiarity breeds attempt. Familiarity breeds consent. Famous Last Words : "This dungeon is a pushover." Farmers are just plain folks. Fartvergngen:The pleasure of breaking wind. Fascinating Captain. Fast. You want Fast? Here's FAST! Fate drove me here, and told me to get out of the c Fate Protects fools, children and ships named Enterprise Faults are thick where love is thin. Fauns are never Satyr-sfied! Fax me no questions, I'll Fax you no lies! Feel good? Don't worry, you'll get over it. Feel lucky???? Update your software! Feet smell? Nose runs? Hey, you're upside down! Fellow with closed mind often has open mouth. Feminist bookstores have no humor section. Ferengi/IRS:sound that same? I wonder WHYYYY?!?! Few problems cannot be solved by proper application of high explosives. [ffo edom ekoj lirpA tsriF] Fight organized crime, stamp out the IRS! File not found, but if you'll hum a few bars... File not found, I'll load something *I* think is interesting. File not found. Delete *.* and change directory? (Y/N) File not found. Should I fake it? (Y/N) File not found: Loading something that looked similar. Fill'em up with ZIP standard sir? No, ARJ premium please! Find Jesus? I didn't know he was lost. Try under the sofa Find out how many friends you have... rent a beach villa. Fine = Tax for doing wrong. Tax = Fine for doing fine. Finish your mail packet! Children are offline in India. Fire all phasers! Fire at will, Not at Will! "First shalt thou pull out the Holy Pin" First they take your money, then your clothes. Fish and guests smell in three days. Fish are so hard to toilet train. Flattery is the sincerest form of lying. Flim flam? * Worf Floggings will continue until morale improves! Floppy not responding. Format hard drive instead? Follow the wise few rather than the vulgar many. For a REAL sponge cake, BORROW all the ingredients. For a snark is a boojum, you see. For an exciting time, type ECHO Y | FORMAT C: > NUL For every action, there's a = govt. agency. For every vision, there is an equal and opposite revision For further information, consult GOD. For sale: 1/2 piece of mountain climbing rope - cheap. For the moment. This baby's working. * O'Brien For the snark was a boojum, you see. For those that like that kind of book, that is the kind of book they will like... For your penance, say five Hail Marys and one loud BLAH! Forget everything, as one day everything will forget you. Forget patience! I'm gonna kill something... Forget PRIME DIRECTIVES! Give the BORG Windows! Forget RTFM - Call The Author At Home! (@ 23:45) Forgive your enemies but never forget their names. "FORMAT C: /autotest" - Justice for software pirates. Fortinlee, I downt nead a spel checkr. Found Jesus? Where were his bones discovered? Found on a door in the MSU music building: This door is baroquen, please wiggle Handel. (If I wiggle Handel, will it wiggle Bach?) Founding member: Jasper Pino fan club Four Food Groups: Beer, Chips, Chocolate, Pretzels. Four food groups: Fast, Frozen, Instant & Microwavable Four out five people think the fifth is an idiot. "Frankly my dear, I don't give a download!" - Rhett Sysop Freedom is doing what you like, happiness liking what you do. Friction is a drag. Friday means two more working days 'til Monday. Friends are people you can be quiet with. Friends Come And Go, But Relatives Never Leave..... Friends don't let friends use Windoze. Friends may come and go, but enemies accumulate. Friends, Romans, and countrymen, lend me your ears. Friends, Romans, countrymen, lend me your taglines! Frisbyterian: when you die, your soul goes up on the roof. Frog philosophy: Time's fun when you're having flies! from a different perspeCtive From an island somewhere in the Pacific. From C:\*.* to shining C:\*.* From Canada's beautiful east coast, Nova Scotia! From listening comes wisdom; from speaking, repentance. From the Department of Redundancy Dept. From Victoria, Jewel of the Pacific! FUBAR: Fouled Up Beyond All Repair Funny, only sensible people agree with me. G=Guns, PG=Plenty of Guns, PG-13=More than 12 guns... Gambling: a way of getting nothing for something. Gather 'round like cattle and ye shall be herd. "Gee, Mr. Wizard! Aren't nuclear reactors dangerous?" Gee... What's that ticking in the corner. Gene Police: YOU! Out of the pool. Genius is 1 inspiration and 99 perspiration. Genius is 10 percent inspiration and 50 percent capital gains. Genius may have its limitations, but stupidity is not thus handicapped. Genius starts at the top and works up. Gentleman: one who can play bagpipes but chooses not to. Gentlemen's agreements can get very ungentlemanly. Geometry: what the acorn said after it grew up. Geordi: "I'm too sexy for my beard." George Orr, George orr, Georgeorr, georgeorr,... George Orwell was an optimist. German Word for Constipation: Farfrompooping! Get Back / Don't Let Me Down - Apple - 5 May 69 Get even...With the people that have helped you. Get four Darkovans together, and they hold a dance. Get out of my way, and keep quiet. * Picard Get stoned! Drink wet cement! Get thee down. Be thou funky. Get thee down. Be thou funky. "Gilligan, get their phasers." "O. K., Skipper." Give a man a fish, and he is fed for a day. Show him how to fish, and he is fed for his life. Give a speculator an inch and he'll build a condo. Give a woman an inch and she thinks she's a ruler! Give a woman an inch and she'll park a car in it. Give me the necklace....No...The NECKLACE!!!! Give them all they want, and all they will want is more. Give your child mental blocks this Christmas. GIVE: Support the helpless victims of computer error. Glory is fleeting, but obscurity is forever. "Go ahead and steal my tagline it flatters me." Go ahead, jump. 100,000 lemmings can't be wrong. Go climb a gravity well. God cures and the doctor takes the fee. God give us relatives, but let us choose our friends. God is a comic playing to an audience that is afraid to laugh. God is an atheist. God is not dead - he's alive and autographing bibles at Waldenbooks. God is Pro-Life. God is real, unless declared "integer." GOD is Real... unless declared as an Integer. God isn't dead, he just couldn't find a parking place. God made the Idiot for practice, and then He made the School Board. God made the world in six days and was arrested on the seventh. God's a busy man. KIRK Goin' back, goin' back, goin' back to Nassau Hall. Going the speed of light is bad for your age. Going where no reader has ever gone before! Gone crazy; be back later; leave message. Good humor is the health of the soul, sadness the poison. Good judgment comes from experience; experience comes from bad judgment. Good news from afar can bring you a welcome visitor. Good will is a weapon against which there is no defense. Good words cost no more than bad. Got a DEATH WISH? Join STARFLEET SECURITY today! Got Kleptomania? Take something for it! Got Mole problem? Call Avogadro at 6.02 X 10^23. Got run, my cat got stuck in the printer... Gotta run, the cat's caught in the printer. Government expands to absorb revenue, and then some. Gracias - Danka - Merc - Thank You - Gratzi - RA Graduate of the Darth Vader School of Personnel Management. Grafitti have changed deface of the nation. Grape nuts? I didn't know grapes had nuts. Grass is nature's way of saying "High!" Gravity brings me down. Gravity is a myth -- the Earth sucks. Great hopes make great men. Great minds discuss ideas; small ones, people. Greed captures the essence of the evolutionary spirit. Ground water? Do you mean crushed ice? Group Insurance: A gross of condoms. Grow your own Dope - Plant a Politician. Growing old is mandatory; growing up is optional. Guess what I made for dinner? Reservations! Gun control is being able to hit your target! Gun control is not about guns; it's about control. Gun control means hitting your target. "Gun's don't kill people...Class 2 phasers do!" Guns - today's leading cause of statistics! Guns don't kill people off-line readers do. Habits are at first cobwebs, then cables. Hail to Thee, Shoes, wearer of feet... Halitosis is better than no breath at all. Halloween is NOT Christmas even though 31 oct = 25 dec Hams do it with greater frequency!!! Hand me that dolphin burger. Yeah, the one in styrofoam. 'Hand me that solar-powered flashlight...' Handle yourself with your head, handle others with your heart. Happiness is a hard disk. Happiness is a warm puppy with an empty bladder. Happiness is merely the remission of pain. Happiness is wanting what you have. Happiness is your favorite program moving to OS/2 Happy, happy, happy, joy, joy, joy. Hard Work never killed anyone, so why chance it? Hardware Independent: Won't work on ANY hardware! Hardware: the part you kick. has any one seen my tagline? hAS ANYONE SEEN MY cAPSLOCK KEY? Have a nice day - void where prohibited. Have I found God? What? Did you lose him AGAIN?! Have we learned _from_ our past, or merely _about_ it? Have you had your 50,000-lines-read checkup yet? Have you hugged an electric fence today? Have You Hugged Your Sysop Lately? "Have you lived in this village all your life?" "No, not yet.".... Have you sucked a crawfish head lately? Have you tried on your smile today? Having a good memory is useless unless you have something good to remember. Having problems with DOS?? Call 1-900-WHAAAAA He "May I kiss you?" She "Heavens, another amateur!" He does the work of 3 Men...Moe, Larry & Curly He does the work of three men: Larry, Moe and Curly. He has been upset ever since he found out there was no Santa Claus. He is a fool who cannot be angry, but he is a wise man who will not. He is almost a statesman. He lies well. He is no lawyer who cannot take two sides. He keeps differentiating.... flying off on a tangent. He liked to like people, therefore people liked him. He lives long that lives until all are weary of him. He that falls in love with himself will have no rivals. He that knows little soon repeats it. He who always plows a straight furrow is in a rut. He who dies with the most toys - is dead. He who dies with the most toys is still dead. He who hesitates is last. He who is flogged by fate and laughs the louder is a masochist. He who is most concerned is always the last to hear. He who knows all the answers never gets asked the questions. He who laughs last didn't get the joke. He who laughs last is probably your boss. He who laughs last is S-L-O-W. He who laughs, lasts. He who laughs... lasts. He who loses his head is usually the last one to miss it. He who mistrusts most should be trusted least! He who never sticks out neck, never wins by nose. He who puts his nose to the grindstone is a bloody fool. He who sacrifices his conscience to ambition burns a picture to get ashes. He who slings mud looses ground. He who smiles in a crisis has found someone to blame. He who sneezes without a handkerchief takes matters into his own hands. He who spares the guilty threatens the innocent. He who steps on others to reach the top has good balance. He who tells you how great he is usually isn't. He who trains his tongue to quote the learned sages will be known, far and wide, as a smart-ass. He wouldn't recognize subtlety if it hit them on the head He's Dead Jim, thats 10 this week already He's Dead Jim. Get His Phaser, I Got His Wallet. He's dead? I thought he was imitating Al Gore. He's dying Jim! He's got a Magnet!......... Everybody BACKUP!!! He's not dead, he's "metabolically challenged". He's so dumb he thinks Cheerios are doughnut seeds! He's studying to be a child molester at the Seminary. Health is merely the slowest possible rate at which one can die. Health is not valued until sickness comes. Health is the slowest possible rate at which one can die. Health: The slowest possible rate at which one can die. Heard on Noahs' ark: Sailing is fun, but scrubbing the decks is aardvark. Hearts may agree, though heads differ. Heisenburg may have slept here. Helium: what doctors do. Hell hath no fury like the lawyer of a woman scorned. Hello, I am part number ޺۳ݳ Help fight truth decay. Help I've fallen and I can't SHEZ up. Help Me Please! Help stamp out and abolish redundancy! Help Stamp Out Intolerance! HELP! HELP! I'm being repressed! Help! I'm being held prisoner in a fortune cookie factory! Help! I'm modeming... and I can't hang up!!! Help! I'm parked diagonally in a parallel universe. "Help! I've fallen and can't get up." A. Tree Help! I've fallen and can't reach the keyboard. HELP!!!!This computer is taking over my life!!!! "Help, I've fallen and I can't get up" -- Satan Here I sit, in a tizzy - all my favorite boards are busy. Here today, dawn tommorow. Here's the latest baseball scores...1-3, 4-2, 1-2, & 4-6. Here, Ensign Expendible--stand on this rock. Hey Rocky: Watch me pull a SYSOP out of my hat! Hey Santa! How much for your list of naughty girls? Hey! Those aren't dilithium; they're Folgers crystals! Hey! Who took the cork off my lunch? Hey, Ain't that your dog attackin' the president? "Hey, Buddy....Can you spare a tagline?" Hey, don't pick up that dogWNO TERRIER Hey, only in America, huh?! Hey, whats that beeping noise? Wheres that smoke comi Hi! I'm bored, heavily armed, and have a Bible. Hi! I'm Joe Isuzu . . . Hi, I'm a virus. Add me to your CONFIG.SYS file! Hi, my name is John, and I'm a closet lurker. Hidden DOS secret: add BUGS=OFF in your CONFIG.SYS Hindsight is always 20/20. Hire teen-agers while they still know everything. His fork only has one tong. Historian: person with extra-century perception. Historians prophesy about the past. "History tends to exaggerate." -Colonel Green History: An illusion caused by the passage of time. Hit any user to continue. Holmdel NJ CIS 75116,2000 Home is the nicest place you will ever go. Home of DOORLIB, the QB45 "DOOR LIBrary" Homer Simpson is my hero. NOT! Homer Simpson: Mmmmmmmm... Beer! Homo Sapiens is a virus & the earth has it. Honest, officer! The dwarf was on fire when I got here. Honestly, the new modem's working just fi{Œ Honesty is almost always the best policy. HONEY! Put that shotgun DOWN! I'm quitting NOW!! Honey, I Formatted the Kid! Honey, PLEASE don't pick up the pajّ Honey, tell Santa I need more ammo... "Honey, This is..." TO BE CONTINUED...see next tagline. Honk if you love obscene gestures. Hoooow much is that Blooonde in the window!? Hope is sweeter than possession. Horse sense is what keeps horses from betting on people. Hot dogs are best when served with a ballgame. Houseguests, like fish, stink after the third day. HOUSEWORK never killed anyone, but why take the chance!! How about a helicopter with an ejection seat? How blind are those who refuse to see? How can you avoid hurting someones feelings without being a liar? How can you tell if a man is lying? His lips move! How come wrong numbers are never busy? How did Simple Simon tell his two horses apart? The black one was two hands taller than the white! HOW DID YOU KNOW I WAS A NEW USER? How do I set my laser printer to stun??? How do you double the value of a Pinto? Fill the tank. How do you know it's summer in Seattle? The rain's warmer How do you know when you have run out of invisible ink? How do you make Windows faster? Throw it harder! How do you tell when you run out of invisible ink? How does AVON find so many women willing to take orders? How does one spell socialism? l-i-b-e-r-a-- How long a minute is depends on what side of the bathroom door you're on. How long befor it happens here? "How many of you believe in telekinesis? Raise MY hand! "How to Stay Poor and Enjoy it Less" By I.R.S. How wonderful opera would be if there were no singers. How you look depends a lot on where you go. How you look depends on where you go. HQelQp! MQy kQeyboarQd hQaQs bQeeQn tQakeQn oQveQr. Hugh Hefner is a virgin. Human beings were created by water to transport it uphill. "Humans are not allowed to dance in this parade." Humorists...Those who can talk sensibly about a controversy. Hungry men think the cook lazy. Hydrogen and Stupidity - the two most common elements. Hydrogen bombs make great party gags! Hypocrisy is the Vaseline of social intercourse. I *HATE* it when my serial port goes Snap Crackle Pop! I *like* unmitigated gall. * Worf I added water, the oatmeal still taste odd. Oh, HOT water "I am a Klingon, sir. I *DO NOT* whistle while I work!" I am Al of Borg. Aww, Peg, I assimilated you last year.. I am an optimistic pessimist. I am ashamed of the Gospel NOT I am Barney of Borg. You will be nauseated. I am Beldar of Borg. We will assimilate mass quantities. I am CopyCat of Borg. Your tagline will be assimilated. I am Dangerfield of Borg. Respect is irrelevant. I am Descartes of Borg: I assimilate, therefore I am. I am Ed McMahon of Borg. You may already be assimilated. I am Elmer Fudd of Borg. Pwepawe to be Assimiwated. I am free of prejudices. I hate everyone equally. "I am Fudd of Borg! Pwepawe to be assimiwated!!!" I am Homer of Borg, prepare to ... ooohhh DOOONUTS! I am Homer of Borg. Prepare to be... ooooohh, doughnuts! I am Jeff ... And I will help you. I am Jordan of Borg. Gravity is irrelevant. I am Locutus of the Borg. This tagline is irrelevant. I am not a complete idiot. Some parts are missing. I am not arguing with you; I am telling you. I am not discriminatory, I hate everyone equally I AM NOW in Yuba City and I'm still not ASHAMED! I am Shakespeare of Borg. Prepare to be, or not to be. I am the root of some evil... send some money. I am their leader, which way did they go? I am Zsa Zsa of Borg. Prepare to be assimilated dahling. I backed up my hard drive and ran into a bus. I BBS because no one can read my handwriting! I believe in free will - I have no choice! I believe in The Divine Right of SysOps. I believe there is a higher power: it's called the government. I believe virtually everything I read * David St. Hubbins I bet you were one hell of a bartender..... I bought a cured ham. It had a pulled Hamstring... "I bought powdered water the other day. I don't know what to do with it." I brake for brick walls. I call things as I see them. Otherwise, I make them up. I came real close to seeing Elvis, then my shovel broke. I came, I saw, I c!)@(#*$&%^ Carrier Lost... I can never find the time to procrastinate. I can resist everything except temptation. I can walk on water, but I stagger on alcohol. I can't be overdrawn! I still have cheques! I can't decide whether to vacillate or not. I can't remember the last time I forgot something. "I can't use contractions." - Data I can't use Windows. My cat ate my mouse ! I certainly don't. I come from a minority, my parents loved me. - B. Seigel I couldn't repair your brakes so I made your HORN louder. I couldn't think of anything stupid to say here I CRUSH YOUR HEAD!!! I didn't mean to blow up the Academy - Wesley "I didn't mean to blow up the Academy." * Wesley I didn't write this; a very complex macro did. I disagree with what you say, but will defend to the death your right to tell such LIES! I distinctly remember forgetting that. I don't believe in miracles, I rely on them. I don't care what happened today. I don't do Windows, but OS/2 does. I don't GET headaches, I GIVE them! I don't have a solution but I admire the problem. I don't know what I like, but I know what art is. I don't know where you get your delusions, Laser Brain I don't steal tag lines; I just recycle them. I don't think you're supposed to do that... I drank WHAT!? * Socrates "I drank WHAT!?" - Socrates I escaped from a political correction facility... I feel more like I do now than I did before. I figure that my psychic should know when to call me. I finally got it all together, but forgot where I put it. I forgot all about the Amnesia Conference!! I fought the lawn and the lawn won. I found my Trill....on blueberry hill...... I get mail, therefore I exist. I got real close to seeing Elvis, but my shovel broke! I had a life once... Now I have a computer. I had no idea you were such a cad. I'm impressed. * Q I had one just like it.... only different. I hate making predictions; especially about the future! I hate taglines. "I hate Victor Hugo", said Les miserably. I have .25 Clusters per Sector. I have a black belt in haiku. I have a crank to start my car. She drives me to work,too. I have a firm grip on reality. Now I can strangle it. "I have a large seashell collection. It's scattered I have a magnetic personality - keep me away from diskettes. I have a photographic memory, but I've run out of film. I have concluded that life is an nP complete problem. I have decided to devote my entire career to looking for a career. I have great faith in agnosticism. I have made no undetected errors... I have one nerve left and you're getting on it... I have tried relaxing but somehow I just feel better all up-tight. I haven't lost my mind...it's backed up on tape somewhere. I haven't lost my mind; it's backed up on tape somewhere I just bought a cured ham. Wonder what it had? I just got back from the future and saw this tag I knew Doris Day before she was a virgin. I know a good tag line when I steal one I know it all, I just can't remember it all at once. I know my efforts deserve my goals, but are my goals worth my efforts? I know so little, but I know it fluently... I know the sun don't shine on the same dogs *** all the time, but I have been in the shade for years...... I know where the Second Foundation really is! I lied! I'll NEVER be alright! I like kids, but I don't think I could eat a whole one. I like work... I can sit and watch it for hours. I Link! U Link! We All Link for I Link! I live in a quiet neighborhood -- We use silencers. I live so far in the country, my zipcode is EIEIO! I LOVE the smell of cordite in the morning! I love the smell of RAID in the summer! I love this game! I love this technical talk. I made it foolproof, but they're making better fools... I may be lost, but I'm way ahead of schedule. I may have settled in shipping. I may not be right, but I'm never wrong! I must have a rapier wit; everyone keeps parrying. I must hurry, for there they go and I am their leader. I mustanottagottalotta sleep last night. I need a practice target... Wesley! * Worf I need more taglines. This one is getting old. I need some duck tape. My duck has a quack in it. I never buy books on impulse. Only on warp. I never metamucil I didn't like. I never metaphysics I didn't like. I often daydream about my inability to fantasize. I parked my harddisk - and got a ticket! I passed my ethics course. I cheated, of course. I played poker with tarot cards; got a flush and five people died. I poured Spot remover on my dog, and now he's gone! :-( I practice safe eating...I use condiments. I prefer to call it thePrimeSuggestion:Kirk&KJKS "I put spot remover on my dog. Now he's gone" - SW I read comic books all day lon%$#^ NO CAREER I refuse to grow up... :-) I remember when Saturns were rockets, not cars. I run OS/2 2.0 on my XT without a hitch. NOT!!! I said copy the disk - not xerox it! I saw Elvis. He sat between me and Bigfoot on the UFO. I see a moderator! Quick--change the subject! I sentence you to hang by the neck until you cheer up. I shave with Occam's razor I smell a rat. Did you bake it or fry it? I spilled spot remover on my dog. Now he's gone. I started out with nothing. I still have most of it. Davis. "I still live!"--John Carter, formerly Capt., CSA I support drug tests. Test the politicians. I support Shareware.. Register Yours. "I sure smell bad after wearing these leathers." * Troi I tag, therefore I am. I thank my lucky stars I'm not superstitious. I think I think, therefore I might be. I think I'd kill for a Nobel Peace Prize. "I think I'll use a different font," said Tom boldly. I think I'm diagonally parked in a parallel universe. "I think not," said Descartes, and promptly disappeared. I think that I shall never see a billboard lovely as a tree. I think, therefore I am overqualified. I think, therefore I am... dangerous. I thought about being born again, but my mother refused. I thought I was wrong once, but I was mistaken. I thought YOU took the house keys ... I tried an internal modem, but it hurt when I walked. I tried OS/2 once, but I didn't inhale. I tried the rest but bought the best!!!! I tried to drown my problems but they can swim. I tried to play my shoehorn, but all I got were footnotes. I type softly and carry a *BIG* electromagnet "I used to be a stud, now I'm a spud." I used to be an agnostic, but now I'm not sure.... I used to have a handle on life, then it broke. I used to jog, but the ice kept falling out of my glass. I used to read books. Now I read .qwk files. I voted for Change! And that's all I've got left. I wanna see Kirk's sock drawer. "I WANT IT FREE AND I WANT IT YESTERDAY." I want to be a veterinarian because I love children. I want to live with a synonym girl. I was a war baby; one look at me and my parents fought! I was an only child......eventually. I was going to procrastinate, but I put it off. I was on a roll, 'till I slipped on the butter. I was Rush Limbaugh in a previous life. I was the next door kid's imaginary friend. I was trying to comprehend the meaning of the words.Spock I welcome criticism write yours here _______ I will answer sick and arrows of troubles I wish life had an editable scroll-back buffer ... I wish my M-5 had 4DOS... I wouldn't mind being poor if I had lots of money. "I wouldn't mind having a relationship with an I wouldn't want to belong to any club that would have me as a member. 'i' before 'e', except in Budweiser I'd always wondered about that. I'd be a narcissist, but I'm WAY too ugly. I'd explain it to you, but your brain would explode. I'd give my right arm to be ambidextrous.. I'd have written sooner but I thought I owed you money. I'd love to, but I'm up to my elbows in waxy buildup. I'd love to, but there's a disturbance in the Force. I'd rather lose my memory than my..ummm...ahhh...never mind. I'd rather marry a duck-billed platypus... 'I'll be Bach.' - Johann Sebastian Schwarzenegger. I'll call it the James Kirk Memorial Brothel * Scotty I'll have one brain on drugs with bacon, toast and juice. I'll Have What The Fellow On The Floor Is Having I'll have what the guy on the floor is having I'll jump off that bridge when I come to it. I'll just nip out and shoot myself. I'll see you on the Dark Side of the Moon. I'll tell you what's the matter! This parrot is dead! I'm "flower units" about you, too. I'm a confirmed sexist. I prefer sex! I'm a counsellor, not a contortionist! - Troi I'm a fragment of your imagination. I'm a good boy! - Ten "I'm a lawyer." "Honest?" "No, the usual kind." I'm a modemer and I'm OK. I post all night and I sleep all day. I'm a natural blonde, so please speak slowly. I'm a paranoid schizophrenic always out to get myself... I'm a pea - I can feel a princess through 50 matresses. I'm a virgin, but I'm just not very good at it. I'm all for computer dating, But I wouldn't want one to marry my sister. I'm an apathetic sociopath - I'd kill you if I cared. I'm as confused as a baby in a topless bar. I'm at the corner of Walk and Don't Walk. I'm BETAzoid. See? Here's the tape... I'm dappled and drowsy and ready to sleep. I'm definitely positively maybe decisive. I'm donating my body to science fiction! I'm FLYING...I'm FLYING....>THUD< I'm growing older but not up . -Jimmy Buffett I'm having an out-of-money experience. I'm hopelessly addicted to my PC and modem! I'm in a phone booth at the corner of Walk and Don't Walk I'm in shape ... decapolyhedron that is. I'm in shape ... round's a shape isn't it? I'm just here for moral support...ignore the gun. I'm leaving my body to science fiction. I'm living proof that God has a sense of humor. I'm more humble than you are! I'm multitasking... I'm reading in the bathroom. I'm neither for nor against apathy. I'm NOT 30..I am 18 with 12 years experience! I'm not a crook. I'm just ethically challenged. I'm not a Ferengi.. I'm ethically challenged. I'm not a Kennedy, my pants just fell down! I'm not a programmer but I play one on TV... I'm not a sysop, I just play one on the echoes. I'm not a Vulcan, but I play one on TV * Leonard Nimoy I'm not a Windows user, but I play one on TV. I'm not arrogant, I'm RIGHT! I'm not asking you to LIVE in sin, only to visit awhile.. I'm not Canadian, although I tend to like their bacon. I'm not conceited, I just can't stand mortals. I'm not dead, I'm metabolically challenged. I'm not easily offended--please try harder. I'm not FOR apathy, and I'm not AGAINST it. I'm not lost, I'm "locationally challenged." I'm not nearly as think as you confused I am. I'm not old. I'm chronologically gifted. I'm not paranoid! Which of my enemies told you this? I'm not paranoid. Which one of my enemies said I was? I'm not rude, I'm "attitudinally challenged". I'm not short and heavy, I'm just traveling near the speed of light. I'm not short; I'm "vertically challenged." I'm not sloppy, I'm organizationally challenged. I'm not telling where my spots end! * Dax I'm not ugly, just aesthetically challenged. I'm only paranoid because everyone's against me. I'm out of bed and dressed. What more do you want? I'm positively enameled with this subject. I'm practicing assertiveness. Do you think that's okay? I'm proud to have been a part of your moral decline. I'm sensing large dripping globs of chocolate. * Troi I'm so full, I don't think I could download another byte. I'm so poor, I can't even pay attention! I'm sure it's clearly explained in the Zmodem DOC's. I'm terribly sorry, but I'm afraid you're just a mirage. "I'm too sexy for my slug." -- Jadzia Dax I'm trying to find myself. Has anyone seen me lately? I'm warning you! One step closer and I'll drop carrier! I'm wobbling and I can't fall down! Weeble I'm writing a book. I've got the page numbers done. I'mmmm too sexy for my taglines, too sexy for my.... I've been seduced by the chocolate side of the force. I've boldly gone where no one has gone before. I've fallen and I can't get down, James Brown I've fallen, and I get get up! I've got a mind like a... a... what's that thing called? I've had BETA days ... and nights!!! I've never met a GUI I couldn't crash. I've seen you before. Milk carton? I've told you a million times to quit exaggerating. I've upped my standards. Now, up yours. IBM - Making tomorrow's mistakes TODAY! IBM stands for 'Inferior But Marketable' IBM: I've Been Misled. IBM: When you care enough to spend the very most Icons... blech, ptoowie! Idealism increases in proportion to the distance from the problem. If 10% is good enough for God, it should be for the Feds. If a cow laughs hard, does milk come out of it's nose? If a man could have half his wishes, he would double his troubles. If a sight is worth seeing, someone will build a highway to it. If a tree falls and hits a mime, does he make a sound? If all else fails, immortality can be assured by spectacular error. If all men were brothers, would you let one marry your sister? If ambition doesn't hurt, you do not have it. If Americans have TagLines, do the English have TagQueues? If anyone has an idea why I do this, keep it to yourself. If at first you DO succeed, try not to look astonished+ If at first you don't succeed - suck another seed. If at first you don't succeed, call it version 1.0 If at first you don't succeed, change the version # If at first you don't succeed, deny you even tried. If at first you don't succeed, destroy all evidence that you tried. If at first you don't succeed, ignore the docs... If at first you don't succeed, skydiving isn't for you. If at first you don't succeed, try cash ! If at first you don't succeed, you'll get lots of advice. If at first you don't succeed, you're about normal. If Clinton didn't inhale, how come his brain is fried? If credit can possibly go to someone else, it will. If debugging is the process of removing bugs, then programming must be the process of putting them in. If every fool wore a crown, we would all be kings. If everyone is on the bandwagon, who's gonna pull? If everything seems to be going well, you've probably overlooked something. If facts do not conform to the theory, they must be disposed of. If God had been in favor of homosexuality, He never would have created Anita Bryant! If God lived on Earth, people would knock out his windows. If God thought that nudity was okay, we would have been born naked. If God wanted us to vote he'd give us candidates If guns are outlawed, how will we shoot the liberals? If homosexuality is disease, can I call in queer? If I buy the steel wool, can you knit me a Porsche? If I can't take it with me, I ain't goin'. If I had my life to live over again, I'd make the same mistakes sooner. If I put water in my dog's mouth, will bells ring? If I save the whales, where do I keep them? If I save time, when do I get it back? If I want your opinion, I'll ask you to fill out the necessary form. If I were here more often, I wouldn't be gone so much. If IBM has Bugs, does an Apple have Worms? If idiots could fly, then this would be an airport. If ignorance is bliss - then why aren't you smiling? If ignorance is bliss, why aren't more people happy? If it ain't broke, let me have a shot at it.... If it falls on your head you know it's a rock If it feels good, don't do it. If it is to be, it is up to me. If it is worth fighting for, it is worth fighting dirty for. If it isn't borken, don't fix it. If it jams, force it. If it breaks, it needed replacing anyway. If it screams, it's best not to eat it. If it screams, it's not food... yet. If it wasn't for C we'd be using BASI, PASAL, and OBOL! If it wasn't for C, we would be using BASI, PASAL and OBOL! If it works, don't fix it. If it's not worth doing, it's not worth doing well. If it's seems to Good to be True: IT IS!!! If it's stupid, but it works, then it's not stupid. If it's tourist season, where do I get a license? If it's tourist season, Why can't we shoot them? If J. Paul Getty opened a health resort, would it be a Spa-Getty? If love is blind, lingerie makes great braille. If love is blind, why is lingerie so popular? If nobody measures up, check your yardstick. If nothing is impossible, how do you get off a mailing list? -Dik. If only women came with pull-down menus and online help. If passion drives you, let reason hold the reins. If people listened to themselves more often, they would talk less. If practice makes perfect, and nobody's perfect, why practice? If puns are outlawed, only outlaws will have puns. If Q were castrated, would he become O? If rabbits feet are so lucky, what happened to the rabbit? If Reagan is the answer, it must have been a very silly question. If reality wants to get in touch, it knows where I am. If sanity were dollars I'd be bankrupt. If screwups were dollars, I'd be a millionaire!! If space is a vacuum, who changes the bags? IF STONE(ROTATION) > 1 THEN MOSS(PROPAGATION) = 0 If the customer wants vanilla, give him vanilla. If the shoe fits, buy it. - Imelda Marcos If there is no God, who always pops the next Kleenex? If there is no God, who pops up the next Kleenex? If there isn't a law, there will be. If thine enemy offend thee, give his child a drum. If this isn't war, why is CNN massing on the border? If this tagline is stolen, it will self-destruct! If this wasn't a tagline it wouldn't be stolen! If this were an actual tagline, it would be funny. If time heals all wounds, how come the belly button stays the same? If U smoke after sex, U're doing it too fast If Windows sucked it would be good for something. If written correctly, legalese is perfectly incomprehensible. If ya can't say anything nice, sit by me. If you ain't Moslem, you ain't Shiite. If you are what you eat, does that mean Euelle Gibbons really was a nut? If you aren't going all the way, why go at all? If you believe in telekinesis, raise my hand. If you buy Yarnball Tribbles, YMBAT. If you can read this, you're in range. If you can see the floor, it doesn't need to be cleaned. If you can't be offensive WHY BOTHER? If you can't beat your computer at chess, try kickboxing. If you can't dazzle them with brilliance, baffle them with bullshit. If you can't laugh at yourself, make fun of other people. If you come up with a lemon, make lemonade. If you don't ask, you'll NEVER know. If you don't have a memory like an elephant, leave tracks like one. If you don't know what it does, don't fool with it! If you expected it to be easy, you should have become a politician. If you get up one time more than you fall you will make it through. If you had one less chromosome, you'd be a Simpson! If you have to be responsible, it's not power. If you have to tell people you're famous, you aren't. If you have to travel on a Titanic, why not go first class? If you haven't found something strange during the day, If you hear an onion ring, please answer it! If you itch for it, scratch for it. If you know SHEZ then you know power!! If you love life, it will love you back. If you pay peanuts, you get monkeys. If you pull the wings off a fly, does it become a walk? If you run after two hares, you will catch neither. If you save the world too often, it begins to expect it. If you say "Come" when the doorbell rings, YMBAT. If you see an onion ring - answer it! If you shoot a mime, should you use a silencer? If you smoke after sex, you're doing it too fast If you stand up to be counted someone will take your seat. If you take the plunge, return it by Tuesday. If you think talk is cheap, try hiring a lawyer. If you think yesterday was a drag, just wait until you see tomorrow! If you think you have no faults, that makes one. "If you touch my stomach, I'll slug you." - Dax If you wanna know the value of money, try to borrow some. If you want something badly, that is how you get it. If you want to cheer up, cheer up someone. If you want to kill time, why not try working it to death? If you're going to bump it, do it on the trumpet! If you're not rejected at least three times a week you're not really trying. If you've got part of it, flaunt that part. If your feet smell and your nose runs, you were built upside down. If your parents didn't have children, odds are that you won't either. If your ship doesn't come in, swim to it. If {COMMO} is a porche then Qmodem is a Volvo. Ifyoucanreadthisyouhavebeenreadingtoomanytaglines. Ignorance is temporary; Stupidity lasts forever!!! Illegal parameter "SOLDIER.GAY": Discharge/ Ignore (D/I)? Illiterate? Write for FREE HELP! Im n bsd 砀n-nd nw u$ mmdt!!H Imagine a witty phrase here. Immortality consists largely of boredom--Zefrem Cochrane Impeach Clinton! And her husband too! Imprisoned in .QWK file! Send the ZIP army! Improbability drive engaged.... > tHHGttG Improve mail delivery... mail the posties their pay!! Improve your memory, forget about work. In a cat's eyes, all things belong to cats In any organization there will always be one person who knows what's going on. This person must be identified and fired. In case of emergency, break glass, scream, bleed to death. In case of fire, yell "FIRE!" In case of injury notify your superior immediately - He'll kiss it and make it better! 'In closing' is always followed by the other half of the speech. In DBLSPACE no-one can hear you scream... In England there are 60 religions and 3 sauces..... In every large problem is a small problem waiting to get out. In every real man a child is hidden who wants to play. In fair weather prepare for foul. In God we trust, all others we voice verify. In God we trust; all others pay cash. In His REAL name, YESHU I X Y In need of a good reformatting. In order to get a loan, you must first prove you don't need it. In order to reach the sea, a river often detours around many obstacles. In other words, I paid MS so I could reformat my drive! In politics you can often be wrong but never in doubt. In space...no one can hear you "Cha! Cha! Cha!" In stereo where available. .elbaliava erehw oerets nI In the beginning, God didn't have an installe In the presence of great men, even fools hide their faults. In the race for quality, there is no finish line. In which level of metalanguage are you now speaking? #include #include Incompetence knows no barriers of time or place. Inconceivable! - Vizzini Incontinence Hotline...Can you hold, please? Incorrigible punster - Do not incorrige. Indecision is the key to flexibility. Individualists of the world - UNITE! Industry standard: The way IBM *WON'T* do it. Infinity means a 100% probablity of everything. Innuedo: An Italian suppository. Insanity is just a state of mind. Insomnia isn't anything to lose sleep over. Instead of being born again, why not just grow up? "Instead of headlights, I put strobe lights on my Instruction ends in the classroom, but education ends only with life. Insufficient Memory: Remove the "Buffers=655,360" line. Interchangeable parts ... Don't. Intuition is reason in a hurry. Invest in physics - own a piece of Dirac! Is a computer language with goto's totally Wirth-less? Is a Jamaican terminal a raster-farian? Is it OK to yell 'MOVIE' in a crowded firehouse? Is reading in the bathroom considered Multi-Tasking? Is that an XT? Oh, you're running Windows. Is that Pee Wee Herman in the Barney suit? "Is that seat saved?" "No, but we're praying for it." Is the "Truth" so bizarre it is unbelievable? Is there a lawyer is the house? -=}BLAM{=- Any more? Is there a Lemon Law for Presidents too? Is there any truth to the rumor that everything is really okay? Is this yours? Your dog left it on my lawn. Isn't 'Dumb Blonde' a peroxymoron? Isn't this the OFF-TOPIC conference? It ain't the size of the pencil, but how well you write It has been discovered: research causes cancer in rats. It has yet to be proven that intelligence has any survival value. It is a good day to die. - Worf, son of Mog It is a sin peculiar to people to hate their victims. It is always much harder to find a job than to keep one. It is as natural to die as to be born. It is better to be hated than to be ignored. It is better to be wise than to be smart. It is better to die on your feet than to live on your knees. It is better to know useless things than nothing? It is better to suffer wrong than to do it. It is better to wear out than to rust out. It is easier to get forgiveness than permission. It is impossible to make anything foolproof because fools are so ingenious. It is morally wrong to allow a sucker to keep his money. It is more shameful to distrust one's friends than to be deceived by them. It is never too late to learn. It is not necessary to fall into a well to know its depth. It is what we can make of the mess we have made of things It isn't the whistle that moves the train. it looks like an optical illusion, but it isn't. It may be that perpetual peace can only be brought about by perpetual war. It only works when you're not looking. It said "Insert disk #3", but only two will fit. It takes 11 cockroaches to mail a letter. It takes 4 years to get a PhD and 40 years to get over it It takes a mature person to be really young. It takes all Types(tyles) and I want them ALL! It takes as much energy to wish as it does to plan. It was a brave person who first ate an oyster. It was not my intention to amuse you. Spock STV It was the best of lines, it was the worst of lines. It was the best of times, it was the worst of times. It's a dirty job, but someone's gotta pawn it off on someone else. It's a fine line between fishing & standing still. It's a small world, but I wouldn't want to paint it. It's a terrible thing to waste one's mind -Dan Quayle It's always darkest before you step on the cat. It's always darkest just before you step on the cat. It's as easy as 3.14159265358979323846.... It's bad luck to be superstitious. It's better to burn out than to fade away! It's better to retire too soon than too late. It's easier to do good than be good. It's easy to suggest the solution when you don't know the problem. It's Ensign Pillsbury, Jim. He's bread. It's GOOD To Be The Queen - Majel Barrett Roddenberry It's hard to be humble when you are so perfect. It's lonely at the top, but you eat better! It's mind over matter - it you don't mind, it don't matter. It's never too late to have a happy childhood. It's not 55mph, it's 147,840 furlongs per fortnight. It's not a matter of life and death - it's much more important than that. It's not a perfect world, but what's your excuse? It's not a rumor. It's something I heard. It's not cute being this easy. It's not hard to meet expenses, they're everywhere. It's not how old you are but how you are old. It's not my fault, I didn't touch it! It's not only fine feathers that make fine birds. It's not only who you know but what you know about who you know that counts. It's only a hobby ... only a hobby ... only a It's only eighteen inches between a pat on the back and a kick in the pants. It's really quite a simple choice: Life, Death, or Los Angeles. It's smart to pick your friends, but not to pieces. It's such a fine line between clever and stupid * Tap It's sweet to be remembered, but cheaper to be forgotten. It's terrible when your cats tease you. It's too early in the morning for that Star Trek crap!! It's Worf, Madame, not Woof. * Worf Ith i nk m y ha r d d i sk i sfr a gme n te d ! Its hard to be graceful getting off your high horse. Its not a bug, its a hidden and seldom used feature! Its not a bug, its an undocumented feature... Its Payday and I have Catalogs! *Milwaukee, WI* its the admiral o god we are gowing to die!!!!! Ivo Andric - Yugoslavia's First Nobel Laureate Jamie Farr: Vulcan sex with an out-of-work actor. Je suis Marxiste, tendance Groucho! Jealousy is the greatest evil. Jealousy: all the fun you think they have. Jean-Luc, I just love your new hairstyle! * Q Jean-Luc, I love it when you're boring. * Beverly Jean-Luc, I never knew you were such a cad! --Q Jehovah-Jireh! Our Provider! Jesus saves sinners and redeems them for VALUABLE prizes! Jim, you don't ask the Almighty for his I.D. Bones JIM...His brain is GONE! * Bones Jimmy Hoffa, call your office. John Galt lives! Johnson & Johnson Tagline: ۰ "ouch" Join the apathy club. We don't care! Join the Frustrated SysOp Society today! Joseph Stalin's grave was a Communist Plot. Judge people by what they are, not where they are. JUMP! -- One hundred thousand lemmings can't be wrong. Junk: stuff we throw away. Stuff: junk we keep. Jurassic Park: dinosaurs real, actors simulated. Just a relocated Blue Hen's chick, here... Just adding features because 'it won't hurt' -- does. Just another line in the field of time. Just because you're paranoid doesn't mean they AREN'T after you. Just bungled it trying to be smart. Just don't let Kirk show you what he calls "The Captain's Log." Just don't tell the asylum you saw me here. Just fill out one simple form to win an IRS Audit! Just my luck - my psychotic episode is a rerun. Just one more question... Just when you think you're winning the rat race, along comes a faster rat. Justice: A decision in your favor. Keep America Beautiful - swallow your beer cans. Keep America Beautiful.... emigrate. Keep laughing at death, and eventually at least you may die laughing. Keep repeating: It's only four years...... 'Keep the smoke inside.' -- 1st Rule of Electronics. Keep your eyes open before marriage, half shut afterwards. Keep your words soft and sweet, in case you have to eat them later. KENNEDY COMPOUND - KEEP OUT - TRESPASSERS WILL BE VIOLATED Keyboard: device used to enter errors into the computer. Khotso Pula Nala * Peace Rain Prosperity Kibitzer: A person with an interferiority complex. Kids-They're not sleeping, they're recharging! Kindness consists of loving people more than they deserve. Kindness is like a boomerang - it always comes back. Kirk to Enterprise, Kirk to Enterprise! DAMN,It's BUSY! Kirk, Spock, Mccoy and this is..Was Ensign X Kisses are love's messengers. Kissing a man without a moustache is like eating an egg without salt. Klein bottle for rent - inquire within. Kleptomaniac: a rich thief. Klingon Battle Cruisers Uncloaking...or is it Odo? Klingon DOS: That command or file name has no *honor*! Klingon tagline: Strike any user when ready. Klingon Thanksgiving Grace: "Let us prey..." Knock firm but softly. I like soft firm knockers! Knowing Murphy's law won't help. Knowledge is knowing that you don't know. Knowledge is power - if you know it about the right person. Knowledge is power! (but so is batteries!) La la la la la AAAAAAGGGH! - The Smurfs versus Godzilla La vie est une maladie mortelle transmise sexuellement. Labor: one of the processes by which A acquires property for B. Lake Erie died for your sins. LAKOTA v1.0 LAPD Motto: We Treat You Like a King Larry is the name and, Plastics are my game Latin is a real angina gluteus maximus. Laugh and the world thinks you're an idiot. Laugh while you can Monkey Boy! Laughter lubes life's engine. Laughter...The no side effect tranquilizer. Law of Supply: It's yours if you don't need nor want it. Lawmakers should not be lawbreakers. Lawrence O. Johnstone * Ukiah, CA * GEnie: L.JOHNSTONE2 "Lawyer Testing" :because some things, even RATS won't do Lawyer: the larval form of a Politician Lawyers work in their briefs. Lawyers: the larval form of politicians. Lead me not into temptation; I can find the way myself. Leakproof seals ... Do. Learn from your parents mistakes; use birth control. Learn why the world wags and what wags it. Learning isn't a means to an end; it is an end in itself Learning to build we learn integrity Left lane must turn right. Left to themselves, things tend to go from bad to worse. Leftists are among the first to speak of their rights. Less government is better! Less is more. "Less talk! More Synthehol!" -- Worf Let a fool hold his tongue and he will pass for a sage. Let him who is stoned cast the first sin. Let me know if you didn't receive this message! Let not your tongue cut your throat. Let the meek inherit the Earth, I want the stars! Let us remember that ours is a nation of lawyers and order. Let's organize this thing and take all the fun out of it. Let's see your tagline hunting liscense, DIXON! Let's see your tagline hunting permit, sir. Lets all take the TIME to really LISTEN 2 r KIDS Liberal tagline: friends don't let friends make up their own mind. Life - brief interlude between nothingness and eternity. Life and liberty are safe only when congress is in recess. Life is a bifurcated chaotic attractor-and then you die. Life is a horse, either you ride it or it rides you. Life is a sexual transmitted disease that is always fatal Life is a yo-yo and mankind keeps tying knots in the string. Life is full of undocumented features! Life is just a figment of my imagination. Life is one long process of getting tired. Life is only understood backward, but must be lived forward. Life is sexually transmitted and invariably terminal Life is the art of being well-deceived. Life is too short not to be in love ! Life is what goes by while you are watching television. Life is what happens to you while you're making other plans. Life would be easier if I had the source code Life would be much easier if I had the source code. Life's contradictions tend to grow Life's not passing me by....it's RUNNING ME OVER!!!! Life...MTBF? Light at end of tunnel will be out until further notice. Light at the end of the tunnel? Look out for that train. Limbaugh Institute FOR Advanced Conservative Studies. Limit M.P.'s to two terms...1 in Parliament & 1 in Jail. Lions & tigers & bears oh my! Little things attract little minds. Little things come in small packages. Live long and suffer - ancient Vulcan curse. Live now -- procrastinate tomorrow! Loafer - someone trying to make two weekends meet. Loan someone a sympathetic ear. Locked coathanger in car; good thing I had a key. Logic is a pretty wreath of flowers that smells bad Logic is neither an art or a science but a dodge. Logic! Logic! Logic! I'm sick to death of Logic. Lonesome is being the "first" modem user Long live the C64! G-g-guys? I was only kiddin, Look its a babble fish: ><> < ><> Looking for a good time? Call Troi at 1-900-NCC-1701 Looking for a helping hand? There's one on your arm. Looking out for #1, trying not to step in #2. Lose weight - eat stuff you hate. Lose weight - put a scale in front of the 'frig. Losing makes winning worthwhile. Losing your drivers' license is simply God's way of saying 'BOOGA, BOOGA!' Lost episode: "Doctor Who and the YATI" LOTUS - Let Only The Users Suffer. Love America - or give it back. Love does much but money does more. Love is a matter of chemistry; sex is a matter of physics. Love is grand, divorce is twenty grand. Love is like a pair of socks - you must have two and they have to match. Love is nothing more than sentimental measles. Love sees no faults. Love shines like a burning star falling from the sky. LSD makes your CGA monitor display 16.7 million colors. LSD melts your mind, not in your hand. "Lubricant. Pennzoil. Steaming hot." * Locutus of Borg Luxuriantly hand-crafted from only the finest ASCII. Lwaxanna Troi - irresistable grace. LX v2.00 "Harry... keep the change." Lysdexia: a peech imspediment we live to learn with... M'liss, you may take off that storter now. MacIntosh: Computer with training wheels you can't remove. Mad at your neighbor? Buy his kid a drum! Madness takes its toll; please have exact change. Mafia DOS: "thisa you lasta chance [Y/N]?" Maintenance release - The janitor wrote it! Make a living, but make room for life. Make friends with SYSOPs; [P]age at 3:00 a.m. Make Headlines..use a corduroy pillow.... Make it as simple as possible, but no simpler. Make the most of the best and the least of the worst. Man is the only animal that blushes... or needs to. Man's reach should exceed his overbite. Managing programmers is like herding cats. Managing senior programmers is like herding cats. Mandatory tagline not required for this message Many a man never fails because he never tries. Many times in order to receive something, you have to ask for it. Many would be cowards if they had enough courage. Marching to the beat of a different kettle of fish... Marriage is punishment for shoplifting in some countries. Marriage isn't a word, it's a sentence. Marxists do it with class. Mary had a little lamb, support Planned Parenthood. Mary had a little lamb. The doctor was surprised. Massive expenditures obscure the evidence of bad judgments. Math and alcohol don't mix. Please don't drink and derive. May all your PUSHes be POPed. May I buy less government please? May the bugs of many programs nest on your hard drive. May your Gakh never wonder off your plate. Maybe it was something your mother took during pregnancy. McBorg's -- over half a billion assimilated. McBorg: Over 50 million assimilated. Me and my two friends... GIF and Wesson. Me hates peoples who don't use gooder English. Me, indecisive? I'm not so sure about that. Meaningless TagLine Version 1.0 Copyright (c) 1993 Meets government specs, if any are applicable. Megahertz--when something is really painful. Member ACNE:Anonymous Computer Nerds Eclectic Member IBTT: International Brotherhood of Tagline Thieves Member, Intn'l Guild of Tagline Thieves, Local #218 Member: Tagline THIEF'S Local #5156 Men are most apt to believe what they least understand. Men are neither suddenly rich nor suddenly good. Men have many faults, women only two, all they say & all they do. Men invented computers to drive women crazier! Men show their character best by the things they laugh at. Menbers 182-195, Multiple Personality Society Mental Floss prevents Moral Decay. "MEOW"...SPLAT..."RUFF"...SPLAT...(Raining cats & dogs) Mercifully free of the ravages of intelligence. "Message for you, sir!" MetroLink * Crunchy Frog: We Enforce Anarchy METRONOME - a small person riding the subway. Mice Krispies - Breakfast food for the healthy cat! Mickey Mouse wears a Ronald Reagan watch. Microbiology Lab: Staph Only! Microsecond: Amount of time needed for a program to bomb Microsoft Piracy Hotline 1-800-NO-COPYN. MicroSoft Support isn't! Microsoft Windows - proof that P.T. Barnum was correct. MICROSWIFT DOS -- for extra slow computing 1-900-CRASHIT Microwaves frizz your heir. Military intelligence is a contradiction in terms. Military justice is to justice what military music is to music. Millihelen: unit of beauty required to launch one ship. Minding your own business will not be tolerated. Minds are like parachutes..They only work when they're open. Minds, like parachutes, work only when open. Minnesota ... Home of the MOOSEquito MIRAMANEEEEEEEEE! * Kirok Misery loves company, but company does not reciprocate. Misery no longer loves company; nowadays it insists on it. Misfortune: the kind of fortune that never misses. Misfortunes one can endure - they come from outside, they are accidents. But to suffer for one's own faults - Ah! there is the sting of life. Missing keyboard - press F1 Misspelled? Impossible. My modem is error correcting. Mistakes will happen, but don't give them too much help. Mister Worf, show these children the airlock. Picard Mistrust first impulses, they are always good. Modem: How a Southerner asks for seconds... MODEM: Modus Operandi Device for Evil Minds Modern man is the missing link between apes and human beings. Modesty is a vastly overrated virtue. Modesty is good bait when fishing for praise. Mommy! The cursor's winking at me! Mondays are the potholes in the road of life. Money Can Make You Rich! Money can't buy poverty -- you sort of have to earn it. Money is like a promise, easier made than kept. Money is like manure - it is meant to be spread around. Money is the root of all evil, but man needs roots. Money is the root of all evils. Send $20 for more information. Money is the root of all wealth. Money lent to a friend must be recovered from an enemy. Money makes not so many true friends as real enemies. Money talks! Mine just said goodbye!! Money talks, anyone can understand it. Mongo only pawn in game of life. 'Monopoly? No, we just don't want competition.' "More hay, Trigger?" "No thanks, Roy, I'm stuffed!" More people are run down by gossip than by automobiles. More people have died in Teddy Kennedy's car than in nuclear power plants. Morfy's law - Enythink thit ken go rong willl. Morning after pill for men - it changes your blood type. "Morning Darling." >> Q to Picard" Most great discoveries start with making a mistake. Most men have died without creating; not one has died without destroying. Most people don't care what happens so long as it doesn't happen to them. Most people raise their voice rather than reinforcing their point. Most visions of utopian society don't take into account that the idealogical descendants of Ghengis Khan and Attila the Hun are alive & well & sitting next to you on the bus. Jim Porcher 198? Mount St. Helens should have used earth control. Move your vowels every day or you'll get consonated. Moving fast is not the same as going somewhere. MP stands for Magnificent Pension. Mr. La Forge, show these children the antimatter * JLP "Mr. Worf, scan that ship." "Aye, Captain... 300 DPI? "Mr.Worf,you're the most beautiful sight I've ever seen" Mrs. Ghandi is in a sari state. MSI - Redefining Telecommunications in '93 Multimedia: Offline reading and wearing a Walkman. Multitasking = screwing up several things at once. Murder is just an extroverted suicide... Murphy IS out there ... WAITING... Murphy was an optimist. Murphy's Golden Rule: Whoever has the gold makes the rules. Murphy's Law fails only when you try to demonstrate it. Must Go - Our Rotweiler needs its teeth sharpened. My 286 is really a Pentium with an identity crisis. My baby done erased me from the hard disk of her heart My BBS is baroque now. Please call Bach later with your Handel. My brain operation was considered minor surgery. My Canada includes Florida from November until April... My Canada includes Wisconsin from November until April... My cat has 9 lives, but my frog croaks daily! My computer isn't that nervous...it's just a bit ANSI. My computer NEVER loc My computer's sick. I think my modem is a carrier. My dad hit me only once - with the Buick. My disappointments come in all sizes, to fit my hopes. My driving teacher had a pitchfork & he wasn't a farmer. My favorite mythical creature? The honest politician. My God, Bones. What have I done? What you had to do. My God, it's full of falling stars! "My God, it's full of stores!" - 2001: A Shopping Odyssey My Guru told me there'd be lifetimes like this. My hailing frequencies are open, Sir. Uhura My hard disk is full! Maybe I'll try this message section My horse got shot, so I had to break his leg... My Hovercraft is full of eels. My kid just beat up your honor student. My last original thought died of loneliness. My life has a superb cast, but I can't figure out the plot. My life is not organized around high probability events. My machine will do lunch with yours. My mind ain't so open that anything can crawl right in. My opinions may have changed, but not the fact that I am right. My other brain's an Einstein. My other computer has Lwaxana Troi's voice. My other computer is a Compaq 386! My other computer is a Pentium. My other tagline is funny. My other vehicle is a Ferengi Marauder. My other vehicle is a Galaxy Class Starship... My other vehicle is also a Galaxy-class starship. My reality check just bounced. My system goes down more often than a $10 whore. My tagline can beat up your tagline. My tagline is in the shop. This is a loaner. My wife and I were happy for 20 years. Then we met. My wife gives good headache. My wife or my modem? Gee, I'll miss her.... Nature Always Sides With The Hidden Flaw ! Necessity is a mother.......... Necrophilia: a dead art.. Neil Armstrong tripped. Neither rain, nor snow, nor l?ne nLoi * Kira No honest man ever repented of his honesty. No man is a fool always, but all men are fools sometimes. No man is an island, but some of us are long peninsulas. No man is lonely while eating spaghetti - it requires so much attention. No matter how thin you slice it, it's still baloney. No matter how you slice it, it's still a golf ball No matter where you go, there you are. - B. Bonzai No matter where you go, there you are. Go see yourself! No matter where you go, there you are. Right here. No matter which way you spit, it's up wind. No matter who you vote for the government wins! No mud can soil us but the mud we throw. No offence intended to those that offence not intended to. No one can get ahead of you when they're kicking you in the rear. No one can make you feel inferior without your consent. No one ever said freedom was free. No pointed ears, but you sound like a Vulcan. McCoy No problem is so formidable that you can't just walk away from it. No purchase required, details inside package. No sense being pessimistic. It wouldn't work anyway. No sense in being pessimistic. It wouldn't work anyway. No special reason, just government policy. No speech can be entirely bad if it is short enough. No straw, no camel's back, but SOMETHING broke...! No Tag No thanks. I already have a nagila. No wanna work. Wanna bang on keyboard. NO! It's MY keyboard! Get AWAY! Get your OWN!!!! No, dear - smoke is SUPPOSED to come out... No, I'm not related to Ross Perot!! * Quark "No, let us not go to Camelot. It is a silly place." No, Taco Bell is NOT the Mexican Phone Company! No, that chair isn't saved. But we're praying for it! No; not dead, "electroencephalographically challenged." No?! Some people still read mail a packet at a time?! Noah saved animals from the flood by arcing them! Nobody ever puts out a sign that says NICE DOG. Nobody goes there anymore, it's too crowded.... None Nostalgia gets old. Nostalgia isn't what it used to be... Not a real tagline, but an incredible soy substitute. Not all the cookies are in the jar. Not good enough, dammit! Not good enough! * JLP Not tonight dear, I have a modem. Nothing could be finah than to be in Carolina! Nothing cures insomnia like the realization that it's time to get up. Nothing found on any drive . . . (R)etry (C)ry (D)rink Nothing great was ever achieved without enthusiasm. Nothing increases your golf score like witnesses. Nothing is 100% certain, bug free, or IBM compatible. Nothing is as easy as it looks. Nothing is interesting if you're not interested. Nothing is opened more often by mistake than the mouth. Nothing is so smiple that it can't get screwed up. Nothing is sometimes the best thing to say. Nothing like fresh men for the gators. Nothing makes a vacation seem better than hindsight. Nothing motivates a man more than to see his boss do an honest day's work. Nothing really happens until it happens to you. Nothing that is worth knowing can be taught. Nothing ventured... nothing gained... nothing taxed!!! Nothing vouchered, nothing gained. Nothing wrong that reincarnation won't cure. Nothing's impossible for those who don't have to do it. Notice how no one criticized Riker until Wesley was gone? Now is the time for all good men to come to. Now now, we're not schizophrenic, are we? Now this won't hurt a bit.... Now using Qmail DeLuxe...and loving it! Now we see the violence inherent in the system! Now where did I put that tagline? Now where did I put those transwarp drive specs? ... "NOW" is a point in time that is already gone. Now, I 'accidentally' put it together when the last few Now, witness the power of this FULLY operational Tagline! _NOW_ I understand! Nudists are people who wear one-button suits. "Nuke 'em till they glow, then shoot 'em in the dark!" Nuke the Whales! NuqDaq'oH puchpa''e' O che sciagura d'essere senza coglioni! O God, our help in ages past, our hope for years to come: Obey little! Resist much! Question authority! Eat fibre! Obi Wan Kenobi at the dinner table: "Use the FORKS, Luke" Objectivity is in the eye of the beholder. Objects on screen are closer than they appear... Observe the face of the wife to know the husband's character. Occasional chair: What is it the rest of the time? Of all liars, memory is the most convincing. Of all the things I've lost, I miss my mind the most. Of course I Know what I'm doing... ...NO CARRIER Off-line Readers are commie plots to drive us crazy! Official host of the OFF-TOPIC conference. OFFLINE 1.50 "Don't Panic" Oh dear, it's dawn again. Oh no, not again... Oh no, not another learning experience! Oh smeg. What the smegging smeg's he gone and done? Oh sure! But what's the speed of dark? 'Oh what a tangled web we weave' - Hair Club for Men. Oh yea, so what can the Phone Company D#&* NO CA Oh, forget the DOCS, just see if it blows up! Oh, goody! My Alludium Q-36 Explosive Space Modulator! Oh, heavy is the burden of being me. * Q Oh, hell! My mood ring just exploded! Oh, I'm sorry...were the voices in my head bothering you? Oh, I've had such a curious dream! said Alice. Oh, very clever Worf. Eat any good books lately? Oh, well... never mind! Oh, yeah? Well, beam THIS up, pal! Oink, FLAP! oink, FLAP! oink, FLAP! oink, FLAP!* OK, I'm weird! But I'm saving up to be eccentric. Ok, now for a quick backuA&#^1s Ok, now let's see what happens WITHOUT the parrot. OK. I got a life. Now, what do I do with it? Okay, I pulled the pin. Now what? Where are you going? Okay, I'm crazy! But I'm saving up to be eccentric! OL "Power corrupts. Absolute power is kind of neat." Old age = you + 20 years. Old age and treachery will overcome youth and skill. Old age comes at a bad time in life. Old age needs so little, but it needs that little so much. Old frogs never die...But they do croak! Old is always fifteen years older than I am. Old is needing a fire permit for your birthday cake. Old is when your back goes out more often than you do. Old musicians never die, they just decompose. "Old poets never die, they just ride off into the sonnet." Old soldiers never die. Young soldiers do. On a clear disk you can seek forever On all lasergrams: Don't forget the Zap code. On finding a stone we see no dog; on seeing a dog we find no stone. On the cutting edge of software disolution. On the edge of a precipice, only a fool does cartwheels. On the other hand... you have five different fingers. On the wall of the women's restroom on the Enterprise: "Where no man has gone before". On what conclusions do you base your facts? One accurate measurement is worth a thousand expert opinions. One already wet does not fear the rain. One can never underestimate the intelligence of the electorate. One enemy can harm you more than one hundred friends can do you good. One good turn gets all the blankets! One hand cannot applaud. One is tolerant only of that which does not concern him. One kid I put thru college, the other I put thru a wall. One legged girls are pushovers... One lie makes many. One lie or one peanut...One leads to another. One man plus courage is a majority. One man`s theology is another man's belly laugh. One murder makes a villain, millions make a hero. One must be poor to know the luxury of giving. One nice thing about egotists: they don't talk about other people. One of the great labor-saving devices of today is my spouse! One of the great labor-saving devices of today is tomorrow. One of the hardest secrets for a man to keep is his opinion of himself. One of these days is none of these days. One of these words is illegible. One peels a problem like an onion. One seventh of our lives is spent on Mondays. One trick pony: Qmodem riding with a Wildcat on a Mustang One way to stop a runaway horse is to bet on him. One who has a clear conscience has a foggy memory. ONLINE ? Good! Hit to take the I.Q. Test Only a ballplayer's errors are published every day. Only a mediocre person is always at his best. Only adults have trouble with child-proof bottles. Only by the negation does one arrive at the affirmation. Only fools say it can't be done. Only God can make random selections. Only Hugh can prevent Lore's fighters. Only the game fish swims upstream. Oops! You found another "Undocumented Feature!" OPCODE: AAR = Alter at Random OPCODE: AND = Accelerate Noisy Disk OPCODE: AWTT = Assemble with Tinker Toys OPCODE: CAPH = Convert All Prime numbers to Hex OPCODE: CBNC = Close, but no Cigar OPCODE: CLBRI = Clobber Register Immediately OPCODE: CLD = Close Logical Door OPCODE: CMPSW = Copy Multiple Programs to Standard Window OPCODE: CNB = Cause Nervous Breakdown OPCODE: COLB = Crash for Operator's Lunch Break OPCODE: CPPR = Crumple Printer Paper and Rip OPCODE: EXOP = Execute Operator OPCODE: EXPP = Execute Political Prisoner OPCODE: FLI = Flash Lights Impressively OPCODE: FSM = Fold, Spindle and Mutilate OPCODE: FSRA = Forms Skip and Run Away OPCODE: HLT = Hide Last Term paper OPCODE: IAE = Ignore All Exceptions OPCODE: IIB = Ignore Inquiry and Branch OPCODE: INT = Invade Next Terminal OPCODE: IRET = Ignore Request and Explode Terminal OPCODE: JO = Jail Owner OPCODE: JP = Junk Program OPCODE: PVLC = Punch Variable Length Card OPCODE: RA = Randomize Answer OPCODE: RASC = Read and Shred Card OPCODE: RCB = Read Command Backwards OPCODE: RDA = Refuse to Disclose Answer OPCODE: RDB = Run Disk Backwards OPCODE: SQPC = Sit Quietly and Play With Your Crayons OPCODE: SRT = Steal Roy's Taglines. OPCODE: SSJ = Select Stacker and Jam OPCODE: STA = Store Anywhere OPCODE: STROM = Store in Read-only Memory OPCODE: TARC = Take Arithmetic Review Course OPCODE: UER = Update and Erase Record OPCODE: ULDA = Unload Accumulator OPCODE: UP = Understand Program OPCODE: UPCI = Update Card In Place OPCODE: WBT = Water Binary Tree OPCODE: WEMG = Write Eighteen Minute Gap OPCODE: WF = Wait Forever OPCODE: WHFO = Wait Until Hell Freezes Over OPCODE: WSWW = Work in Strange and Wondrous Ways OPCODE: WWLR = Write Wrong-Length Record Open minded? Space Cadet? Vacuum Technology? Open mouth, insert foot, echo internationally. Open WINDOWS and you let BUGS in... Operator halted. Star Trek is on. OPERATOR! Trace this call and tell me where I am. Operator? Give me the number for nine-one-one!! Opinions are like assholes - everybody has one. Opportunities do not wait. Optimist: Commodore computer salesman with a beeper. Orcs really aren't so bad (if you use lots of catsup). Originality is the art of concealing your sources. Originality: Undetected plagarism. OS/2 - The only true 100% FAT free operating system. OS/2 didn't die... Windows NT did! OS/2, 4Dos and 4OS2 : My computer is happy again.. OS/2...Opens up Windows, shuts up Gates. OS/2: JUST SAY NO! OS/2: Upgrades are free. Who would PAY for it OS/2: Your brain. Windows: Your brain on drugs. Others look to you for stability, so hide when you bite your nails. Our Father, UART in Heaven. I/O'd be Thy Name... Our God is an AWESOME God! Our Mission: To Boldly stay home and read mail off line. Our own grief produces pity for another. Our pleasures are imagined, but our griefs are all real. Our warranty doesn't cover fire, theft, or acts of dog. Out to Lunch. If not back by 5, then Out to dinner. Over 49.99% of all people are below average Over the hill? What hill? I didn't see a hill! Oxymoron--open-minded liberal. Oxymoron: "The honor of the French." Oxymoron: Advanced BASIC. Oxymoron: Term meaning stupid as an Ox. P'grammers dont change lite bulbs; that's a hardware pblm 'Paid off'? What does that mean? Pain Farr: Vulcan Sex, but doing it wrong! Pain is forgotten; insult lingers on. Pain is inevitable. Misery, however, is an option. Pain is just God's way of hurting you. Pain is the breaking of the shell enclosing your understa Palindrome: A dog! A panic in a pagoda. Palindrome: Diamond light, Odo, doth gild no maid! Palindrome: Evil I did dwell; lewd did I live. Palindrome: God, a red nugget! A fat egg under a dog. Palindrome: Rats live on no evil star. Palindrome: Taem, no Devil lived on meat. Palindrome: Ten animals I slam in a net. Palm Farr: If PeeWee Herman was a Vulcan Panda Farr: Vulcan sex ... uh, never mind. Pane Farr: Vulcan sex in glass houses Pane Farr: A Vulcan peeping Tom Pang Farr: Vulcan sex while incredibly hungry. Pant Farr: Vulcan sex with your clothes on Pant Farr: Exhausting Vulcan sex. Paper clips are the larval stage of coat hangers. Paperless Office: Your stall in the bathroom! Paradox - n., that which is not a paradox. Paranoid: someone who just figured out what's going on. Pardon me, I've been smoking DSZ docs. Parents, Make The Call! Part of the happiness of life consists not in fighting battles, but in avoiding them. A masterly retreat is in itself a victory. Part-time musicians are semiconductors. Passacaglia - The Ground of Music! Passing on curves: What a beauty-contest judge does. Patience abused becomes fury. Paw Farr: Vulcan sex in a dog house. PCDOS&MSDOS&CP/M&WINDOWSI'LLFIDDLEWITHOS/2WOULDN'TYOU? Peace and long life to DS9.Or at least long life Peace is not the absence of conflict but the ability to cope with it. Peanut prizes inspire monkey contestants. Peck! Peck! Peck! ... Boom! .... Chicken in a Minefield. Pentium: Intel's version of the 586. People forget how fast you did a job, but remember how well you did it. People have one thing in common, they're all different. People have one thing in common: they are all different. People say I'm indecisive. Am I? I don't know. People seldom plan to fail, but they often fail to plan. People seldom want to walk over you until you lie down. People should be measured in feats, not feet. People usually get what's coming to them, unless it's been mailed. People who fly into a rage always make a bad landing. People who kill people give guns a bad name. People who live in stone houses shouldn't throw glasses. People who pun deserve to be drawn and quoted... People will buy anything that's one to a customer. People with narrow minds usually have broad tongues. Permanent solutions never work. Permission to smash the lieutenant's head in, sir. * Worf Perot/Bush/Quayle: The Milionaire, the Skipper & Gilligan Personally, I don't believe in atheists. Pets: pure love contained in soft packages. Petting: A study of anatomy in braille... Pharmaceutical companies have it made. You have to take their vitamins so you can open their medicine bottles. Phase 1 of the Borg conquest: Introduce the GST. PhD: Piled Higher and Deeper! Phone Farr: the Vulcan (900) number for phone sex. Photons have mass? I didn't know they were catholic. "Picard, get some hair. Your brain has caught cold." * Q Pick a window........you're going through it. Pilgrims may follow but there can only be one Columbus. Pilots are just plane folks. Pin Farr: Uh, never mind -- too graphic for G rated conference Pine Farr: Vulcan sex in the wilderness Pioneers are the ones with the arrows in their backs. PKLite Beer? PKZIP: Comprssn ARJ: Cmprssn PKZIP 2.0h: Cm@!"$#*n Plain dealing is more often praised than practiced. Plankton lobbyist: "Nuke the whales!" Plasma is another matter. Plastic packaged foods are very uncanny. Play poker with Tarot cards. Got a flush. 5 people died. Please disregard the previous fortune cookie. Please excuse my driving, I'm trying to reload. Please help me to be patient. And Hurry! Please hold, a representative will annoy you shortly. Please keep your hands off the secretary's reproducing equipment. Please let me know if you did not receive this. Please return stewardess to original upright position Please return stewardess to original upright position. Please wait... Sysop has exited to DOS.. Please, GOD, please save me from some of your followers. Plow a straight furrow and you're in a rut. Plum Farr: Vulcan sex using your thumbs Plum Farr: Vulcan sex while eating fruit Pogo Farr: Vulcan sex on a pogo stick Pogo Farr: Vulcan sex with a cartoon opossum. Poise is the act of raising the eyebrows instead of the roof. Polaroid: What a polar bear gets from sitting on ice. Politeness is the art of choosing among your thoughts. Politically Correct Tagline Politics is the entertainment branch of industry. Politics: Poli=Many, Tics=Blood sucking parasites. Polluting New Jersey...like who's gonna notice? Pollytheism n.; the belief that God is a parrot. Polymer physicists are into chains. PomPom Farr: Vulcan sex with a cheerleader Ponch Farr: Vulcan Sex with Eric Estrada. Poncho Farr: Vulcan sex through a hole in a blanket Pond farr: Vulcan sex in a hot tub. Ponderosa Farr: Vulcan sex on "Bonanza". Ponderous Farr: Vulcan sex with a fat person Ponds Farr: Vulcan sex w/ 1/3 moisturizing lotion Pone Farr: Vulcan sex after eating cornbread Pong Farr: Vulcan sex while playing table tennis. Pontiac Farr: Vulcan sex in the back seat of a car Pontiff Farr: Vulcan sex with a clergyman Pontoon Farr: Vulcan sex on a boat Positive: Mistaken at the top of one's voice. Postmen never die, they just lose their zip. Pound forehead on keyboard to continue... Poverty and love are hard to hide. Poverty is the root of all evil. Power corrupts, but we still need electricity. Power corrupts. Absolute power is kind of neat. Power does not corrupt fools, but fools corrupt power. Practice makes perfect, but no one's perfect, so why practice? Practice random kindness & senseless acts of beauty. Practice safe fax...ALWAYS use a cover slip. Practiss makes perfict. Praise a wife but remain a bachelor. Prawn Farr: Vulcan shrimp sex. Pray as if it were up to God, but work as if it were up to you. Pray for what you want but work for what you need. Precinct toilets stolen! Police have nothing to go on. PREDICTION: You are reading messages right now. Prejudice is the child of ignorance. Preserve wildlife...pickle a squirrel. Press "+" to see another tagline. Press -- to continue ... Press any key to continue or any other key to quit Press any key... no, no, no, NOT THAT ONE! Press CTRL-ALT-DEL if you're for Clinton... Press to test. Release to detonate. Press [ESC] to detonate or any other key to explode. Pretend to spank me - I'm a pseudo-masochist! Pride and grace never dwell in one place. Pride in prosperity becomes misery in adversity. Pride is what we have...Vanity is what others have. Private tag - #  / . Pro is to con as progress is to Congress. Procrastination - the art of keeping up with yesterday. Professionals built the Titanic, amateurs built the ark. Programmer - A red-eyed, mumbling mammal capable of conversing with inanimate objects. Programmer's do it with bytes and nybbles.... Programmers don't die, they GOSUB without RETURN Programmers get overlaid. Programmers never die, they branch off to a new address Progress implies a direction. Prom Farr: Vulcan sex at a high school dance Proofread carefully to see if you any words out. Protect your car: Use a club! Proverbial excrement hits oscillating air device. Prune Farr: well, this could be disgusting.... Prunes give you a run for your money. Psst, your file is open. Psychiairic: Wherever you go, Your not all there Psychiatrists stay on your mind. Psychics will lead dogs to your body. Psychoceramics: The study of crackpots. Pub Farr: Vulcan sex in an English Tavern Pug Farr: Vulcan sex in a boxing ring Pun Farr: Vulcan sex jokes. Pun Farr: Vulcan sex while telling bad jokes Pun: the lowest form of humor, unless you thought of it first. Punch Farr: Vulcan S&M Puns are bad, but poetry is verse! Push something hard enough and eventually it will fall over. Push the button, Frank! "Push to test" .... "Release to detonate" Put all your eggs in one basket, and WATCH THAT BASKET! Put on your seatbelt. I wanna try something.... PUT THE COMPUTER DOWN, HONEY..I'm quitting NOW! Put your nose to the grindstone and you're a bloody fool. Pygmies placed on giants' shoulders see more than the giants themselves. Q - how can I prove I'm mortal? Worf - DIE! Question authority before they question you! Question authority, but raise your hand first. Question: Man invented alcohol. God invented grass. Who do you trust? "Quite a motley crew you've assembled here, Benji." * Q Quoth the Raven, 'Nevermore.' Qu s un rato? El marit de la rata! (c) P. Gol QWKRR128 - Read 'n' Reply offline with a C=128 Rabbits reproduce like taglines. Race Car spelled backwards is Race Car!!! Radioactive cats have 18 half-lives. Radioactive halibut will make fission chips. Raindrops on roses and whiskers on kittens... Raise ducks for a quack profit. Raising Kids Is Like Trying To Heard Cats. RAM disk is *not* an installation procedure. Random (Def.): We don't UNDERSTAND the pattern! Read my chips: No new upgrades! 'Read my lips, no nude Texan's'. What George really said. Reader not found...please notify tagline. Real computer users do it on the command line. Real joy comes from doing something worthwhile. Real power comes out of wall outlets. "Real programmers don't document. If it was hard to write it should be hard to understand." Real Programmers make lousy managers. Real programmers use COPY CON PROGNAME.EXE Real race cars don't have fenders or doors or radios! Reality does not exist - yet. Reality is a fictitious concept I find aesthetically appealing. Reality is a sham. Reality is an illusion produced by alcohol deficiency. Reality is blinking again...call for repairs. Reality is for people who can't face science fiction. Reality is for those who can't handle alcohol. Reality-ometer: [/////....] YOW! Time to get outta here! Reality-ometer: [\........] Hmmph! Thought so... Reality...What a concept! REALITY.SYS corrupted: Reboot universe? (Y/N/Q) Reality: a fantasy gone wrong, dreadfully wrong!!! Realize that EVERYTHING is a cat toy. Really Get Stoned -- Drink Wet Cement! Recent studies show that recent studies are meaningless. Recovering blonde. Recursive, adj.; see Recursive. RED ALERT, SHIELDS UP, PHASORS AND PHOTONS AT READY! Red ship crashes into blue ship - sailors marooned .... Reduce your I.O.U. To I.R.S with an I.R.A. Reincarnation means you never get away with anything. Relax, its only ONES and ZEROS! Relaxed Agnostic-I don't know any answers-I'm not looking Remain seated until this tagline comes to a complete stop Remarriage after divorce is the triumph of hope over experience. Remember when safe sex was not getting caught in the act? Remember, the paper is always strongest at the perforations. Remember: even if you win the rat race, you will still be a rat. Repartee: an insult with a suit and tie on. Repeat..."It's just a show, I should really just relax. Reply not necessary; just send money. Republican's wealth = Middle Class sacrifice Rescue 911 = Kirk's Toupee - The Next Generation Research: noun - plural form of plagiarism. Resistance Is Futile! (If < 1 ohm) Respect must be earned, not commanded. ROBONAP: Sleeps *for* you while you're online. Roll up your sleeves...And you won't lose your shirt. ROM instruction: (R)ead (O)perators (M)ind. ROM wasn't built in a day. Romulan ale no longer to be served at diplomatic function Romulan DOS: Cloaked command or file name Romulan warbird decloaking sir... [ NO CARRIER Romulan warbird FASA attacking sir...Fire the CANON! Ronald Reagan isn't old, he's chronologically challenged! Ronald Reagan: Milli Vanilli of presidents. Ross Perot is the Hamburglar. Pass it on. RTFM !!! RTFM is a four-letter word! RU-486 = "Are You For Stiffin The Kid?" Rubber bands have snappy endings. Rush LimBORG - all other opinions are irrelevant. S not inabliity, and you can do anything you believe S.T.A.N.D. B.A.C.K. Scotty STV Same .BAT channel, Same .BAT time Same to you (whatever you meant by that)! Santa's elves are just a bunch of subordinate Clauses. Sarcasm works better when it's spelled correctly. Satyrs have more faun. Save money buying shoes-they're only .85 at bowling alley Save the Chocolate Moose! Save the whales. Collect the whole set. Say it with flowers...Give her a Triffid. Say nothing & they think your stupid..Talk & they know for sure. Say... They didn't mention THIS in the brochures! Schopenhauer named envy and sympathy as the characteristics that are responsible for the main difference in people, stating that envy created a wall between people and sympathy negated any barrier. Science fiction warps your mind. Engage warp factor 10. "Scotty!, beam me Augggg!" *...NO CARRIER "Scotty, I've fallen & I can't beam up" Screw the Prime Directive! Send the Borg Windows. Second chances aren't usually associated with first impressions. Second star to the right and straight on till morning... Secrecy at my job prevents me from knowing what I do. Secret negotiations are usually neither. Sector not found. Kill Program? (Y)es, (N)o, (S)crew it Sects! Sects! Sects! Is that all Monks think about? Security to 10 Forward. Worf's into the margaritas again. Security to the Bridge! Data is being Formatted! See how they run like pigs from a gun see how they fly... See other side for reading instructions See reverse side for instructions........ "Seek Error" - Who told it to look for anything? Seems just like yesterday . . . Hey! It was! Seize the day, put no trust in the morrow! Horace (8 BC) Self-reference (n.): see Self-reference Seminars: derived from 'semi' and 'arse'; hence, any half-assed discussion. Send a self-abused stomped elephant to... Send more tourists--the last ones were delicious! SENILE.COM found . . . Out Of Memory . . . Senilgat gnidaer emit hcum oot dneps uoY Sensors identify the creatures as "scrubbing bubbles." Sentences are essential elements for writers. Sentient plasmoids are a gas. Serious tagline Serving coffee on aircraft causes turbulence. SET DEVICE=EXXON to screw up your environment. Set Phrases on Pun Sex and Violence:Can't enjoy 1 if you don't survive other Sex is not the answer. Sex is the question. 'Yes' is the answer. Sex: even when it's bad, it's good. Shakespeare of the UFP: To be or not to be.. Make it be! Shakespeare was wrong. It's the _Bankers_! Shakespearecomm...transmits up to 14,400 bard Shakka, when the sewers backed up. Shampoo? No thanks, I'll use real poo. Shareware author dies: .GIF at eleven! She criticized my apartment, so I knocked her flat. She won't last forever, so why give her a diamond? She won't last forever; why give her a diamond? Shell to DOS...Come in Dos, do you copy? Shell to DOS... Shepherd's Pie = 3.141592653589793238462643383279502884197169... sheep. SHEZ is this a four letter word?? Shh! Be vewy quiet. I'm hunting Womulans!! Shift to the left, shift to the right, mask in, mask out, BYTE, BYTE, BYTE !!! SHIN - device for finding furniture in the dark. Shin: A device for finding furniture in the dark. SHOCKING TRUTH: 50% of all people are below average. Shoes for Industry. Shoes for the dead. Shopping Tip: Shoes are only 85 at the bowling alley. Short cut ... The longest distance between two points. Short men who dance with tall women get bust in the eye. Shouldn't you be doing something productive? Si Ivory est pur 99.44%, le .56% qui reste, c'est quoi? Sign in room: Hortas - Please don't eat the urinals! Sign on baby's bib: SPIT HAPPENS. Silence cannot be misquoted. Silence is not only golden; it's seldom misquoted. Silly Rabbit, tricks are for hookers! Silly wabbit, QWKs are for kids. Silver in color, very heavy - He's lead, Jim! Simple... Just do this... * Wesley Since the left half of the brain controls the right half of the body, only we lefties are in our right minds. Since when is the IRS a service? Sir! Romulan Warbird decloaking2O:b NO CARRIER "Sir, I MUST protest; I am *NOT* a merry man!" Worf Sir, sonar reports screw noises. Sirens: What you hear in a Japanese library. Sits he on ever so high a throne, a man still sits on his bottom. Size and color will vary.... Skydiving: Good to the last drop. Sleep is an inadequate substitute for caffeine. Small programs are for small minds. Smash forehead on keyboard to continue..... Smeggin' hell! > Lister Smile - it makes people wonder what you're thinking. Smile! It makes people wonder what you've been up to. Smile! Things can only get worse. Smile! You're on Candid Modem! Smile, It makes people wonder what you're up to! "Smoke me a kipper, I'll be back for breakfast" So many jerks, so few bullets. So Many Messages!.............So Little Time! So much to learn, so little time. So much work, and so few women to do it. So, I hear you're into molinology... So, YOU are the one stealing my taglines! Software Independent: Won't work with ANY software. Software specs: Pick two - [1] Fast [2] Right [3] Cheap Solitude..A great place to visit, but a bad place to stay. Some days I look my best in a thick fog. Some days you step in it...some days you don't... Some days you're a bug, other days a windshield. Some folks feel that beauty times brains is a constant. Some have bread who have no teeth left. Some minds NEED to be altered. Some of us quit looking for work when we find a job. Some people are educated beyond their intelligence. Some people are so afraid to die that they never begin to live. Some people aren't hard of hearing, but hard of listening. Some people fish in the Sea of Life without bait. Some people will believe anything if it is whispered to them. Somebody's terminal is dropping bits. I found a pile of them over in the corner. Somehow I have to believe that I'm worth all the aggravation I cause myself. Something in the next shadow is waiting to eat your face. "Something is different......." Sometimes I wish I could get a mirror with a better view. Sometimes let things happen but sometimes make things happen. Sometimes silence is the best way to yell at the top of your voice. Sometimes the best defense is a skillful surrender. Sometimes the only solution is to find a new problem. Sometimes too much to drink is barely enough. Sometimes wrong, but never in doubt. Sometimes you're a bug..Sometimes you're a windshield! Soon To Be A Major Motion Picture. Sorry, I forgot all about the Amnesia conference! Sorry, I haven't got time to understand anything. Sorry, no tagline. Check back next week. Sorry, the brain you have reached is disconnected. Sorry... my mind has a few bad sectors. Southern Calif., please ration your RAM. Southern DOS: Y'all reckon? (Yep/nope) Spam...it is the devil's work! Speaking without thinking is like shooting without taking aim. Sped up my XT; ran it on 220v! Works greҿ~ SPEED READ does everything but think up new taglines! Spelchecker, plez!!!!? Spelling checkers at maximum! Fire! Spill chequers dew knot awl weighs wok ass wee eggs peck. SPOCK (At least the *tagline* is on-topic) Spock, you are such a putz! Sponsored by St. Ferdinand III: Patron Saint of Engineers Squirrel gravy and grits. Only the pure would understan ST: Deep Space Nine...coming to a TV set near you! Stalin's grave was a communist plot. STAMP OUT TAGLINES "STAND BY FOR MIND CONTROL!!!" --Evil "Star Trek VII: JFK" directed by Oliver Stone! Star Trek: The Geritol Generation * Upcoming TV series Starfleet Academy has a drama department? Statistics can be used to support anything, especially statisticians. STATUS QUO is Latin for "the mess we're in." Status symbol: foam-rubber wind chimes. Stealing taglines, eh? Book him for "grand theft motto." Stepping on people's toes messes up their shine. STICK \'stik\ n. 1: A boomerang than doesn't work. Still going! Nothing outlasts Data..he keeps going and go Stop censorship now, before it stops you! Stop the World, I want to throw up. "Stressed" is just desserts spelled backwards. Strike any user when ready. . . Stupidity does not qualify as a handicap, park elsewhere! 'Stupidity if left untreated is self-correcting' RAH. Success comes in a can. Failure comes in a can not. Success has a thousand fathers, but failure is an orphan. Success has ruined many a good man. Success is a journey, not a destination. Success is a matter of luck; just ask any failure. Success is like a fart - you can only stand your own. Success is not permanent, neither is failure. Suicide is confession and confession is suicide. Suicide words: Hey there, turtle-headed Klingon dude! Support D.A.M.--Mothers Against Dyslexia Support mental health - or I'll kill you! Support mental health, or I'll kill you! Support safe housing; use condos. Support the helpless victims of computers. Support the right to arm bears. Support your local medical examiner: die strangely! Support your local sysop. Suppose that there were no hypothetical situations... Sure fire diet, swallowing pride. Sure, drinking kills brain cells, but only the weak ones. Sure, when...OINK FLAP OINK FLAP...Well I'll be damned! Sure, you START with stealing only taglines, but then.... Surrender now - before I have to offer you better terms. Suspect software piracy? Call the SPA at 1-800-388-PIR8. Suspicion poisons a friendship. Swallow your pride, it is non-fattening. Swallowing angry words is much easier than having to eat them. Synonym: A word used when you can't spell the first one. Syntax? Why not? They tax everything else! Synthetic Scotch..........synthetic commanders. Scotty Tact - changing the subject without changing the mind. Tact is getting your point across without stabbing someone with it. Tag lite--a third less funny than a regular tag. Tagline shortage. Please help recycle taglines. Tagline Thievery ...Comin' up next on Geraldo Tagline thievery...on the next Geraldo! Tagline too old! Please replace by a later version. Tagline Witheld: Patent Pending. Tagline! You're it! Taglines that make you go "Hmmmmmmmmmmmm..." Taglines- the REAL reason for echomail Taglines: Steal all you want, we'll make more! Taglines:The number one reason for getting a mail reader! tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtag Tailgater - one who makes ends meet. TAILHOOK CONVENTION VIOLATES LOOK AND FEEL Take a congressman to lunch. You will need a tenderiser. Take an astronaut to launch. Take my advice, I don't use it anyway. Take my advice...I'm not using it. "Take my Worf......please" - Data Take time to smell the roses and eventually you'll inhale a bee. Talk is cheap because supply inevitably exceeds demand... Talk is cheap since supply exceeds demand. Talk is cheap unless you hire a lawyer. Tax forms should read "income owed us" and "in commode you". Taxes are not levied for the benefit of the taxed. Teachers have class. Teaching is the art of assisting discovery. Teaching is the fine art of imparting knowledge without possessing it. Teamwork is vital! (It gives you someone to blame.) Technological Civilization: Redundant or Contradictory? Ted Kennedy Party Tip - Take Off Pants, Mingle Ted Kennedy's Bumper Sticker: My other car is underwater Teen Lesbian Nazi Hookers Raped by UFOs! - Geraldo Teenagers, God's punishment for enjoying sex. Television is to media what hydrogen bombs are to explosives. Tell a child he got 1 right, not 99 wrong. Tell a lie and find the truth. Tell the truth and run. Tell the truth and you won't have so much to remember. Temper is what gets most of us into trouble. Pride is what keeps us there. Terror: A female Klingon with PMS Tessie, the Porshe 959 of Offline Reader Editors! Test tube babies get a womb with a view..... Test-tube babies shouldn't throw stones. Thank goodness for my twit filter. Thank you for holding your breath while I smoke. Thank you for not annoying me more than you do... Thank you for reading this message! That does not compute. That looks like a...Romulan warbirNO CARRIER That must be wonderful; I don't understand it at all. Molier. That tagline is TRUE -> <- That tagline is FALSE That was a pointing device? My cat thought it was dinner. That was Zen this is Tao That which we resist the most is what we become. That would not be an atypical Romulan ploy. The advantage to being a pessimist is that all your surprises are pleasant. The American Dream BBS moves to Callahan FL Soon "The answer is 42." The attention span of a computer is only as long as its electrical cord. The backup's not over 'til the FAT table sings. "The Balm of Gilead, the Rock of Ages, you are Jehovah!" The beard does not make the philosopher. The bearing of a child takes nine months, no matter how many women are assigned to the project. The beatings will continue until morale improves. The best alternative to INTELLIGENCE is SILENCE. The best defense is a good offense. The best fish swim near the bottom. The best mirror is an old friend. The best thing about growing older is that it takes such a long time. The best thing to hold onto in this world is each other. The best time to buy anything is last year. The best vacations are spent near the budget. The best way to accelerate a MAC is at 9.8 Meters/Sec! The best way to have a good idea is to have a lot of ideas. The best way to keep your friends is not to give them away. The bird that can sing and won't sing must be made to sing. The bird: a nest, the spider: a web, man: friendship. The blood of the soldier makes the glory of the general. The Borg - plastic surgery taken too far. THE BORG: Calm, Cool and Collective... The buck doesn't even slow down here! The buck doesn't even slow down here. The buck stops at the desk over there. The Buck stops here, the Dough just visits.. The cat crept into the crypt, crapped, and crept out agai The chief cause of divorce is matrimony. The chief cause of problems is solutions. The cost of feathers is higher, that makes down up. The cost of memory chips went up. I forget how much. The cow is a machine which makes grass fit for us people to eat. The crisis of today is the joke of tomorrow. The cure may be worse than the disease. The days of the digital watch are numbered. The dead outnumber the living more than 30 to 1. The dentist never talks to his patients until the drill is in their mouths. The devil finds work for idle glands. The difference between ideas and results is a good manager. The difference between snowmen and snowwomen? Snowballs! The difficult we do immediately. Impossible takes longer. The dimmer the light, the greater the scandal. "THE DOCTOR IS ON..." The dog ate my .REP packet. The early bird suffers from insomnia. The Earth is like a tiny grain of sand, only much much heavier. The Earth is our home....Clean your room!!! The Electric Chair Choice: Regular or Extra Crispy. The end is near--but wait for the sequel! The fairest rose at last will be withered. The finest gift is a portion of thyself. The first and worst of all frauds is to cheat one's self. The first Christian gets the hungriest lions. The first loss is the easiest. The first rule of intelligent tinkering is to save all the parts. The floggings will continue until morale improves. The flush toilet is the basis of Western civilization. The fool wanders; the wise man travels. The fool who is silent can pass for wise. The future is like the present, only longer. The future is when you'll wish you'd done what you aren't doing now. The future isn't what it used to be. The future's so bright, I gotta wear shades! The generation of random numbers is too important to be left to chance. The goal of Computing Science is to build something that will last at least until we've finished building it. -- David Oster. The good lord willing and the board don't crash. The graveyards are full of indispensable men. The greatest ability is dependability. The greatest hate springs from the greatest love. The greatest man in history was the poorest. The greatest pleasure in life is doing what people said couldn't be done. The greatest remedy for anger is delay. The harder you work the luckier you get. The hell with the prime directive, let's kill something. The higher the ape climbs the more he shows his bald haunches. The Holistic BBS: Home of the "Post with the Most" The human mind ordinarily operates at only ten percent of its capacity - the rest is overhead for the operating system. The human race has only one effective weapon, and that is laughter. The irony of life is that no one gets out alive The King is a fink! The ladder of success is easier to climb when laid flat. The leading cause of statistics is smoking. The least experienced fisherman always catches the biggest fish. The less a statesman amounts to, the more he loves the flag. The less influence you have, the longer you wait. The less you have to do, the less time you find to do it in. The less you say, the less you have to take back. The longer a man is wrong, the surer he is that he's right. The longer the letter, the less chance of its being read. The longer you keep your temper the better it will get. The longest list has a final item. "The LORD is my Shepherd;..." The majority isn't silent--the government is deaf! The man who has accomplished all that he thinks worthwhile has begun to die. The man who invented the eraser had the human race pretty well sized up. The masses are the opium of religion. The middle of the road holds yellow lines and dead skunks The Military Salute now uses a much limper wrist The mistake you make is in trying to figure it out. The mob has many heads but no brains. The mome rath isn't born that could outgrabe me. The more heavily a man should be taxed, the more power he has to avoid it. The more laws, the more offenders. The more things you own, the more you are owned by things. The more you run over a cat, the flatter it gets. The more you say, the less people remember. The most difficult thing to open is a closed mind. The most exciting place to discover talent is within yourself. The most intelligent people we know are those who ask advice. The most solid stone is the lowest one in the foundation. The most valuable gift you can give your family is a good example. The Next Generation... The next sentence is true. The last sentence was false The non-violent Star Trek: Set phasers on tickle. The nonsensical ravings of a lunatic mind. The number of a person's relatives is directly proportional to his fame. The number of women a man find attractive is truly proportionate to his age. The number you have reached is not in service ! The official Canadian DOS prompt..........EH:\> The old dumb-tagline-on-the-BBS trick! The old know more about being young than the young know about being old. The one who dies with the most toys is dead. The only alternative to perseverance is failure. The only cure for insomnia is to get more sleep. The only one who got everything done by Friday was Robinson Crusoe. The only perfect science is hindsight. The only short meetings are when no one shows up. The only stupid question is the one that isn't asked. The only time some people work like a horse is when their boss rides them. The only wormhole I've seen went through an apple. The other line always moves faster. The pale deaths that men miscall their lives The past looks better the farther away you get. The pen is mightier than the sword. The person who snores loudest will fall asleep first. The pot at the end of the rainbow is not Acapulco Gold. The President sucks - And boy does her husband love it! The problem can't be mine. I am the sysop. The problem with any unwritten law is that you don't know where to go to erase it. The problem with the future is it turns into the present. The problem with the gene pool is that there is no lifeguard. The real objective of a committee isn't to reach a decision but to avoid it. The Real Stephen A. King -- Tustin, Ca. The registered copy don't work either? The road to success is always under construction The road to the patent office is paved with good inventions. The road to understanding is a long, hard path; I was advised to take my lunch and a change of clothes. Wayne Sorge/1981 The rooster may crow, but the hen delivers. The San Andreas fault,the most stable thing in California The seabird hater left no tern unstoned. The secret of education lies in respecting the pupil. The secret of selling yourself is to have a product you truly believe in. The SemWare Editor: THE Power Programmer's Editor!!!!!!!! The shortest distance between two points is generally under repair. The six steps in a project: 1) Unbounded enthusiasm 2) Total disillusionment 3) PANIC!!! 4) Frantic search for the guilty 5) Punishment of the innocent 6) Promotion of the uninvolved. The smallest good deed is better than the grandest good intention. The smallest handcuff in the world is a wedding ring. The soft parade has now begun..! The solution of this problem is trivial and is left as an exercise for the reader. The strangest of all birth defects is an inability to see things my way. The strength of woman lies in her ability to love. The Swedish Chef has been assimilated. "Borg borg borg!" The temporary alternative to death is insecurity. The trouble with reality is there's no background music The trouble with resisting temptation is that it may never come again. The truth is always the strongest argument. The truth is more important than the facts. The truth, however, is not pertinent to the issue. The tweeters are all burned out.... The UART's won't take this speed, Captain The universe is simple - it's the explanation that's complex. The Unknown Soldier...better him than me * Bill Clinton The upper crust is just a bunch of crumbs clinging together. The usefulness of any meeting is in inverse proportion to the attendance. The wages of sin is death. (Which, after taxes, is just a bad feeling.) The weather is here, wish you were beautiful. The word of the day is LEGS....Now SPREAD the word!! The world gets better every day, then worse again in the evening. The world is coming to an end! Repent and return those library books! The world is coming to an end. Ctrl-KX to save & exit. The world is coming to an end. Please log off. The world is full of surprises, very few of which are pleasant. "The world's a theater, the earth a stage" -- WS The world's as ugly as sin, and nearly as delightful. The world's full of cactus, but you don't have to sit on it. The world's gone to the dogs, & the fleas are in charge. The worm in the sour apple doesn't know any better. The worst ice cream flavor is probably squirrel. The worst thing about censorship is . The worst thing about ignorance is its insistency. The young are slaves to novelty, the old to custom. The young know the rules, the old know the exceptions. Them that has gits. Then there was the Formosan bartender named Taiwan-On. Therapy helps, but screaming obscenities is cheaper. There ain't no such thing as a free lunch There are 3 kinds of people - those who can count & those who can't. There are no absolute answers to life - just revelations. There are no ESC keys on prison PCs. There are no facts, only interpretations. There are no winners in life; only survivors. There are three kinds of lies: Lies, Damn Lies, and Statistics. There cannot be a crisis today; my schedule is already full. There goes another Sound Blaster: Snap, Crackle & Pop! There is a difference between a tag line and a philosophy There is a difference between an open mind and a hole in the head. There is always free cheese in a mousetrap. There is never sunshine without shadow. There is no dark side of the moon. Really. There is no gravity, the Earth sucks. There is no X in ESPRESSO. There never was a good knife made of bad steel. There's more planes in the ocean than ships in the sky! There's never time to do it right, but always time to do it over. There's no fool like an old fool, 'cause he's experienced. There's no future in time travel. There's no government like no government. There's so much to learn and so much of it not worth learning. Theres never time to do it right, only time to do it over. Thesaurus: ancient reptile with an excellent vocabulary. These are serious charges. Spock STV These cookies don't taste anything like girl scouts! They are not inherently narrow minded, but it is hard to find one who can look down both sides of an ax blade at the same time. They mean to win Wimbledon! They say give your money to God, but they give you THEIR address. They who give have all things; they who withhold have nothing. Things are more like they are now than they ever have been before. Things are not as bad as they seem. They are worse. Things that make you go, "HMMMMMmmmmmmmmmm . . .?" Things work better if you plug them in. Things worth having are worth cheating for. Think "HONK" if you're a telepath. Think like a man of action, act like a man of thought. Think of it as evolution in action. Thinking is wise, planning is better, doing is best. This tagline is justified . This BBS is ancient. Some say from the echocene. This button doesn't do anything! Please press it again!! This cookie is void where prohibited, licensed, or taxed. This cookie will soon appear as a Bantam paperback. This door is Baroque; please call Bach later. "This hat's not big enough for both of us" :Guinan This information fills a much needed gap. This is a good day to let down old friends who need help. This is abuse. Arguments are down the hall. This is an SOS Call from the mining ship Red Dwarf This is Elvis. Any messages for me? This is Mike Mills's tagline and I've got it! This is your CPU -- This is yor CPU on Windows !#$%)* This is your sysop. Ǵ$ s s dg$. This message will self destruct in 5 seconds...5..4..3..2 This Old Starship - with your host, Montgomery Scott. This score just in - Deep Space 9, Babylon 5. "This sentence no verb." - Douglas R. Hofstader This sentence will end before you can say "Jack Rob This starship brakes for black holes. This tag line for rent. This tagline closed-punchlined for the humor-impaired. This tagline exudes warmth and charm. This tagline has been reclaimed and not yet stolen. This tagline has been taxed by a liberal Democrat. This tagline intentionally left blank... This tagline invisible to all whose I.Q. exceeds mine. This tagline is a charmer. This tagline is inebriated. This tagline is really Constable Odo... This tagline is the victim of a UAE. This tagline is umop apisdn THIS TAGLINE NOT TO BE REMOVED UNDER PENALTY OF LAW. This Tagline will appear 1/2 hour later in Newfoundland. This would easier understand fewer had ommitted. This tagline has a lot of bugs in it ... Those who can, do. Those who cannot, simulate. Those who can, do. Those who cannot, teach. Those who do not learn from History ... get an F. Those who do the most usually demand the least. Those who like sausage or political policy should not watch it being made. Those who live by the sword KILL those who don't. Those who think they know it all upset those of us who do. Thou shalt not covet thy neighbor's tagline Thousands of journeys have a start but no end. Three may keep a secret, if two of them are dead. Three Stages of Sex Tri-Weekly, Try Weekly, Try Weakly Throw well, throw Shell! Time and words can never be recalled. Time flies like an arrow -- fruit flies like a banana. Time flies like wind. Fruit flies like pears. Time for culture, gone Chopin, Bach in a minuet. Time is just nature's way of keeping everything from happening at once. Time is nature's way of keeping everything from happening at once. Time is natures way of keeping everything from happening at once. Time is so everything doesn't happen at once. To a cat, "NO!" means "Not while I'm looking!" To avoid seeing a fool, break your mirror. To baldly go where no one has gone before : Picard To be or not to be, those are the parameters. To be or not to b^&%*$(#)@! Carrier Lost.... To be wronged is nothing unless you continue to remember it. To boldly split infinitives that no one has split before+ to boldly take a writer where none has gone before!!!! To do nothing is in every man's power. To err is human, to moo boovine. To err is human. To really foul things up requires a computer. To err is human; to blame it on someone else is more human. To err is human; to forgive is against company policy. To err is human; to forgive, infrequent. To err is human; to moo bovine. To every rule there is an exception, and vice versa. To find a policeman in a hurry, double-park. To get a loan you must prove you don't need it. To have a friend you must first be one. "To HELL with the Prime Directive...FIRE!" To his dog every man is Napoleon. To iterate is human; to recurse, divine. To know recursion, you must first know recursion. To live outside the law, you must be an honest man. To make a speech immortal you don't have to make it everlasting. To regret nothing is the beginning of wisdom. To rest is to rust. To take a stand, one first must have legs to stand on. To take a stand, one must have legs to stand on. To tell the sex of a chromosome, pull down its genes. Toad - n. What happens to an illegally parked frog. Today I am feeling ept, ane and sipid. Today I am feeling ept, ane, and sipid. Today is the first day of the rest of your life. Today is the last day of your life (so far). Today's subliminal message is . Tomorrow never comes. Tongue tied & twisted, just an earthbound misfit I. Tonight on HTV: Three Men and Rosemary's Baby Too busy to laugh? Then you are too busy. Too few of the bucks stop here. Too many people confuse free speech with loose talk. Too much of a good thing can be wonderful. Too much shareware, not enough registration $$$. Took an hour to bury the cat. Damn thing kept moving. Topologists are just plane folks, Pilots -- plane folks, Carpenters -- plane folks, Midwest farmers -- plain folks, Musicians -- playin' folks, Whodunit readers -- Spillaine folks, Some Londoners -- P. Lane folks. TOURIST SEASON! DOES that mean we can shoot them? Toys are made in heaven, batteries are made in hell. Transwarp drive in 5 4 3 2 1... Trash your "To Do List"; you won't do it anyway. Travel by TARDIS: It's not necessarily faster, but it is definitely more interesting! Treat each day as your last, one day you will be right. Trekkers work out at the He's Dead Gym. Trespassers will be experimented on! Tresspassers will be SHOT, survivors will be SHOT AGAIN! Tribble meets Ford at 65Mph ---> ____ "Tribbles who love Klingons", on the next Oprah! Tried to play my shoehorn... all I got was footnotes! Trouble with political jokes is they get elected. Trust everybody, but always cut the cards. Trust me, I know how how this works.... Trust no government that wants to disarm its citizen. Try Milk of Amnesia - when you need to forget. Trying to sell a product you have never used is like trying to sell a belief you have never believed in. TV is chewing gum for the eyes. Two can live as cheaply as one... for half as long. Two guys walk into a bar. Why didn't the second one duck? Two most common elements in the universe: Hydrogen & Stupidity. Two wrongs don't make a right, but three lefts do. Two's company and three's the result. U.S.S. SPECK, drop your shields or you will be destroyed. UFO's are real; the Air Force doesn't exist. Ultimate office automation: networked coffee Unable to locate Beer -- Operator Halted! Unable to locate Coffee -- Operator Halted! Uncle Sam needs your money - Congress already SPENT it! Understanding is the key. Maybe it's under the mat. Unevaluated Registration Copy Unfair! A battle of wits and you are unarmed! Unicorns aren't myth, virgins are! UNIX: Operating system for the vowel impaired. UNIX: user-viciousness raised to an art form... UNKNOWN WARNING... Contact your local dealer Unregistered Evaluation Copy Unregistered Evaluation Tagline Unwritten laws can not be erased. Us * "Not a problem."--Parker Lewis Use "DEVICE=EXXON" to screw up your environment. Use contraceptives on every conceivable occasion! Used Iraqi rifles for sale: Dropped once, never fired. User - a technical term used by computer pros. See idiot. Users : Keep them dry and don't feed them after midnight. v 1.5 -- Profound interpretations fully supported. Vanity is the food of fools. Variables won't; constants aren't. Veni, Vidi, VCR -- I came, I saw, I videotaped it. Verbal agreements frequently lead to verbal disagreements. Verbosity: Refuge Of Those With Nothing Original To Say. Very funny Scotty - now beam up my clothes! Very good, Einstein, but next time show your work. Veteran, Bermuda Triangle Exploration Team: 1999-1955 Virginity can be cured. Virtuality Has Taken Precedence Over Reality! Virtue is its own revenge. Virus detected! P)our chicken soup on motherboard? Virus Scanner: "Windows found - Remove (Y,n)?" Viruscan V1.22- ** Windows found ** Remove? (Y,+ VirusScan - "Windows found: Remove it? (Y/y)" Visit Scenic Melnibon Visit your money this year - vacation in Washington, D.C. Volume in Drive C: TOO_LOUD! Vote Cthulhu in '96--Why settle for the lesser evil? Vows made in storms are forgotten in calms. W/1/2 my brain tied behind my back,to be fair WACO - We Are the Church of Ordinance. WAD = Working As Designed ( -><- ) Wagner's music is better than it sounds. Wait until it is night before saying it has been a fine day. 'Wait' is a hard word to the hungry. Wait... I was goning to make Espresso Waiter, there are monsters in my transporter * Barclay Walk softly and carry a megawatt laser. Walt Disney is in suspended animation. Wanna do something big? Pick up a boulder. Want to confuse people? Quote from the wrong message! Want to forget all your troubles? Wear tight shoes. Wanted: Programmers. Some assembly required. Wanted: Woman with computer. Send photo of computer. Wanted:386DX Fatherboard to have SX with my Motherboard War is death's feast. War never decides who is right, only who is left. Warner Bros. MIS/AmpTech Software. Burbank/Glendale Ca Warning: any tagline I see is fair game. WARNING: DO NOT LOOK INTO LASER WITH REMAINING EYE. Warning: drinking water may kill your thirst! WARNING: No user serviceable characters in this tagline. Warranty: If it breaks, both halves are yours. Wasting time is an important part of life. Watch out for number one, but don't step in number two. Water created humans so it would have containers. Watson! Check out that Adler babe! We all have our darker side. We need it... We all KNOW you're the daughter of the fifth house!!! We all live in a yellow subroutine. We are NOT surrounded. We are in a target-rich environment. "We are OUT of penicillin, Commander!" * Dr. Crusher "We are the greatest planet on earth." - Dan Quayle. We are verses out of rhythm, couplets out of rhyme. We are watching. And we are always here. "We can't afford to die here...not even once" We do not count a man's years until he has nothing else to count. We do precision guesswork. We do. We are. What more can you ask for? We don't care. We don't have to. We're the Phone Company. We don't really understand it, so we'll give it to the programmers. We got rid of our kids. The cats are allergic! We have a equal opportunity Calculus class -- it's fully integrated. We have engaged the Borg. The wedding is Sunday! We haven't lost a Lunatic; we've gained a co-sysop. We hired you to babysit. You cooked and ate them BOTH? We learn from history that we don't learn from history. We live in a world where nothing is impossible, except peace and happiness. We look for things. Things that make us go. We look for things.....things to make us go! We must believe in free will. We have no choice. We now return to our regularly scheduled flame-throwing. We now return you to your regularly scheduled tagline. We put up with being surpassed more easily than with being equaled. We secretly replaced the dilithium crystals with Folgers crystals... We should back the metric system every 2.54cm of the way. We should go metric every inch of the way. We speak old metaphors, and we feel proud... We sweat so we don't catch fire when making love. We take drugs very seriously at my house... We will, we will, Pun you! We're all going down the same road in different directions. We're all part of the human race but racing faster won't make us more human. "We're Going North Like Hell" We're lost, but we're making good time. We're sorry, but reality is not in service at this time. We've replaced Dilithium with Folgers crystals Weak things united become strong. Wedding rings: the world's smallest handcuffs. Welcome to Westworld, where nothing can go wornggg... Welfare and TV are today's bread and circuses. Well done is better than well said. Well if you need me, I'll call you--and if I want your opinion, I'll give it to you... Well, .............its a good idea, anyway. Well, it was coughin' up blood last night. Wernher von Braun settled for a V-2 when he coulda had a V-8. Wesley & AmeEx junk mail? Are they one and the same?! Wesley, go clean out the photon torpedo tube * Picard Wesley, have you ever seen any ... gladiator movies? What are fiends for? - Richard Nixon What Can I Say After I Say, "OOPS"? Ask Freud? What can ya do at 3am? PSSSTT-got a modem? What do you mean? An African or European swallow? What does this red button do? What fools these morals be! What garlic is to salad, insanity is to art. What General Custer had...an indian summer! What happens if you get scared half to death twice? What happens to the hole when the cheese is gone? What has four legs and an arm?....... A happy pit bull. What I ought to do, I can; if I can, why don't i? What if there were no hypothetical situations? What is all this about violins on television? What is mine is mine, yours is negotiable. What is the half-life of a television set? What is worth doing is worth the trouble of asking someone else to do. What makes Teflon stick to the pan? What many orators lack in depth they give you in length. What may be, may not be. What one does to weeds and grasses. What the large print giveth, the small print taketh away. What the world needs is an electric match. What this country needs is a good five-cent ANYTHING! What this country needs is more unemployed politicians. What was the best thing BEFORE sliced bread? What we are is God's gift to us - what we become is our gift to God. What we do not understand, we do not possess. * Goethe What we learn after we know it all is what counts. What wisdom can you find that is greater than kindness? What you are, not what you have, is what makes you rich. What you enjoy is much more important than what you have. What you see can depend on what you look for. What's another word for thesaurus? What's Love Got To DO With It? It's LUST! What's this button for? ڀ폯....NO CARRIER WHAT? Take you to our leader? PLEASE take him with you! "What?!? This isn't the Files section?!?" Whatever hits the fan will not be evenly distributed. Whatever their faults, the Communists never created canned laughter. Wheaties and beer: the Breakfast of ex-champions. When a man is down everyone runs over him. When a man lies he murders part of the world. When a man's wife learns to understand him, she stops listening to him. When all else fails, read the instructions. When all is said and done more will be said than done. When an agnostic dies, does he go to the Great Perhaps? When an oyster is irritated, it makes a pearl. When angry, count to ten; when very angry, count to a hundred. When everybody is somebody, then nobody is anybody. When faith & hope fail try charity - it's love in action. When governments fall, people like me are lined up & shot When I 1st had sex, I was scared. I was alone! -Rodney When I die, I'm leaving my body to Science Fiction. When I gave her the ring, she gave me the finger. When I lay an egg, I stand back and admire it! When I left this ship. It was in one piece. * Picard When I talk to myself, I'm talkin' to the wrong person. When I want your opinion I'll beat it out of you... When I want your opinion I'll read your entrails. When I was a kid, I was an imaginary playmate. When I was your age we carved our transistors out of wood When in doubt, CHEAT!!! When in doubt, EMPTY THE CLIP! When in doubt, mumble. When in doubt, mumble. When in trouble, delegate! When in doubt, truncat When it comes to giving, some people stop at nothing. When money talks there are few interruptions. When my mind wanders away, I'm left sitting here. When need is greatest help is nearest. When people share their fears with you, share some courage. When policy fails, try thinking. When poverty knocks at the door, love flies out the window. When puns are outlawed only outlaws will have puns When putting cheese in a mousetrap, always leave room for the mouse. When riding dragons, don't let your mind go blank. When shooting a mime, do you need a silencer? When talking nonsense try not to be serious. When taxes are due, Americans tend to feel quite bled-white and blue. When the chips are down, the buffalo's empty. When the igloo is rocking, don't bother knocking! When the People lead, the "Leaders" will follow. When the well is dry we know the worth of water. When two men in business always agree, one of them is unnecessary. When you are in a peach orchard, don't look for turnips. When you are over the hill, you pick up speed. When you get what you want you don't want it as much. When you go far enough, you'll meet yourself. When you go on a diet, the first thing you lose is your temper. When you have sour cream every problem looks like a potato. When you kill time you murder success. When you starve with a tiger, the tiger starves last. When you're over the hill, you pick up speed! When you're over the hill, you pick up speed. When you're through changing, you're through. When you're up to your ears, keep your mouth shut. When you're up to your hips in alligators, you forget the original project was to drain the swamp. When your work speaks for itself, don't interrupt. Whenever I get a grip on reality, the handle falls off. Whenever the Canon is fired,it shoots out a YATI Whenever you learn all the answers, they change all the questions. Wher'd you git that CPU? Out of a Crackerjack box? Where am I and who are these strange people? Where am I going? And why am I in this handbasket? Where am I? And why am I in this handbasket?? Where are we going? And why are we in this handbasket? Where in the world does the guy who has everything put it? Where is "Old" Zealand? Where The Heck is The "Any" Key? Where there's a will, there are five hundred relatives. Where there's a will, there's a lawsuit. Where there's a will, there's an inheritance tax. Where we operate at a 90 angle to reality Whether you think you can or whether you think you can't, you're right. Which is the non-smoking lifeboat? While money can't buy happiness, it certainly lets you choose your own form of misery. White dwarf seeks red giant for binary relationship. Who is General Failure and why is he reading my disk? Who knows most says least. Who loves well is slow to forget. Who needs rhetorical questions? Who tested Preparations A through G, and why? Who the hell is Robin? -Bart Who Will Save the World? The Mighty Groundhogs! Who's General Failure & why's he reading my disk? Who's gonna tinkle this old piano.... "Who's that trip-trapping on my bridge!!??" -Picard Whoever dies with the most toys... is still dead! Whoever lies with dogs rises with fleas. Whoever loves God must love his brother 1Jn4:21 Whoever named it necking was a poor judge of anatomy. Whoever profits by the crime is guilty of it. Whoever rows the boat doesn't have time to rock it. Whoever tries for great objects must suffer something. Whom computers would destroy, they must first drive insane. Whom gods would destroy, they first teach MS-DOS. Why are Chinese fortune cookies written in English? Why are creditor's memories better than debtors? Why are there interstate highways in Hawaii? Why are today's rough times always tomorrow's good old days? Why be a man when you can be a success? Why bother phoning a psychic? - let 'em phone you! Why bother phoning a psychic? Let them phone you! Why did CNN cancel that cool "Desert Storm" show? Why did Kamakazi pilots wear helmets??? Why do expenses always rise to meet income? Why do Kamikaze pilots wear helmets? Why do so many foods come packaged in plastic? It's quite uncanny. Why do they call it rush hour when nothing moves? Why do you always find something in the last place you look? Why does bread always fall butter side down? Why does the other line always move faster? Why don't they make an electric battery... ? Why experiment on animals with so many lawyers out there? Why glue my bills together? It's a mail bonding ritual. Why go second class when 1st class is only $25? Why is "abbreviation" such a long word? Why is 'abbreviated' such a long word? Why is everyone complaining about "youth in Asia?" Why is it that time softens some people and hardens others? Why is there only one "Monopolies Commission?" Why is this tagline different from all other taglines? Why is this thus? What is the reason for this thusness? Why USA fails? Radio Shack=USA's Technology Store!! Why was there a Brady Family Reunion?! Wicked Witch Parking Only - Violators will be toad. Wickedness is its own greatest punishment. Wilderness = Freedom Will compute for food. Will that be cache or chkdsk? Will the real Cmd. Riker please Stand up. Will you come quietly, or shall I use ear plugs? Win at first and lose at last. Win Some Lose Some....But When Do I Win Some? Win without boasting and lose without excuse. WIN.COM not found: (A)bort (R)etry (W)ho cares? WindowError:009 Horrible bug. God knows what has happene+ Windows - how to turn a 486 into an Etch-A-Sketch! Windows 3.1's OS/2 support is "pathetic"... Windows Ice Cream -- Hoggin' DOS Windows is a pane in the ASCII Windows IS NOT a virus. Viruses do something. Windows NT: Vapourware of the desperate and scared. Windows speed tip: type DEL \WINDOWS\*.* Windows: A View to be Killed. Windows: From the people who brought you the 640K limit Windows: Just another pane in the glass. Windows? WINDOWS?!? Hahahahahehehehehohohoho... Windws is ine for bckgroun comunicaions - Bll Gats, 192 Winners never quit and quitters never win. Winning isn't everything, but then losing is nothing. Wisdom consists of knowing when to avoid perfection. Wisdom is knowing what to do with what you know. Wisdom is the sunlight of the soul. Wise men change their minds, fools never. Wise men never play leapfrog with unicorns. Wise people are full of doubts (I think). Wishes won't wash dishes. Wit and wisdom are rarely seen together. Witches use brooms because nature abhors a vacuum. Woman.ZIP -Great program. No docs, but great to UNZIP. WOMEN = Wild Ovulating Man Eating Nymphomaniacs Women do come with instructions, just ask them! Women, wind and fortune soon change. Word Perfect Support can't be beat! Words are not food, though sometimes we must eat them. WORK HARDER!... Millions on welfare depend on YOU! Work is the curse of the drinking man. Work: a necessary evil for money to buy computer stuff. Works for me! 'Would it make any difference if I said I love you?' Would like to go where no one has gone before Would Ralph Kramden use Norton Utilities? Would the Standing Committee sit down? Would you believe... this is a tagline? Would you give your right arm to be ambidextrous? Would you let a bug escape because it did not bite you? Would you trust a POLITICIAN to run the country? Wrinkles are sure signs of where smiles have been. Write your concerns on a $20 bill, and mail to .......... WYMI - All philosophy all the time! WYSIWIG: What you see is fake hair. Xerox never comes up with anything original. Xerox...All they ever do is copy. Yeah, so what's the speed of dark? YELLOW SUBMARINE - Apple - 13 Jan 69 Yep! you bet... What was that you said? Yes my son, long ago mail was read 1 packet at a time. Yes, and by the same token, no. Yeshua - A Consuming Fire Yeshua - the True Vine 'Yield to temptation, it may not pass your way again.' - L. Long. YO! Picard! That just ain't logical! - S'talone of Vulca Yogi Bare was a Buddhist Nudist. You ain't learning nothing when you're talking. You always find something in the last place you look. You are in a maze of twisty little taglines, all alike... You are in a maze of twisty passages... "You are Jehovah, the God that healeth me!" You are making progress if each mistake is a new one. You are never fully dressed until you wear a smile. You are only young once, but you can stay immature indefinitely. You are talking to a Program that passed the Turing test! You are the winner of one of these prizes... You can always find what you are not looking for. You can fool some of the people all of the time, and all of the people some of the time, but you can make a fool of yourself anytime. You can lead a boy to college but you can't make him think. You can lead a horse to water, and if he walks on it patent him. You can lead a horticulture, but you can't make her think. You can never discard too many bad ideas. You can never tell which way the train went by looking at the track. You can observe a lot by just watching. You can preach a better sermon with your life than with your lips. 'You CAN trust the government...ask an Indian.' You can't believe everything you hear, but you can repeat it. You can't have everything... where would you put it? You can't teach people to be lazy - either they have it or they don't. You can't tell a book by its movie. You can't win them all, but you can sure lose them all. You cannot antagonize and influence at the same time. You cannot propel yourself forward by patting yourself on the back. You cannot tell how deep a puddle is until you step in it. You could have knocked me over with a fender. You do *what* on this holodeck? * Scotty You don't buy beer, you just rent it... You don't have to be a cannibal to get fed up with people. You go Uruguay, I'll go mine. You gotta know when to code 'em, know when to modem. You have 2 choices for dinner--take it or leave it. You have the bridge, Number One--I have to go number two! You have to wonder about any period in history in which people are saying that God is dead and Elvis is alive. You have violated Robot's Rules of Order. You have your problems, and I have yours. You in the red uniform, see what that noise is."-- Kirk You Klingon sons, you've killed my bastard... no, wait.. You knew the job was dangerous when you took it, Fred... You know what's going on, don't you? * Ace You know you're getting old when everything dries up or leaks. You make ends meet...and they hate each other! You may now log in to life. Password: ________ You may shut your doors against a thief but not against a liar. You might as well fall flat on your face as lean too far backward. You might as well. I stole yours. You need to relax, Dax. Take a chill pill, Trill! You never "find" time, but you can always "make" it. You never really learn to swear until you learn to drive. You only have a problem if you think it is a problem. You saw my hard disk drive off? Where? You should presently be able to deal from a full deck. You take the blond, I'll take the one in the turban. You want it when?? You whizzed on the electric fence, didn't you? - Satan You will be a winner today. Pick a fight with a three-year old. You will never be younger than you are today...& vice versa. You will spend the rest of your life in the future. You'd make a perfect stranger. You'll never get dizzy doing a good turn. You're a loser when your dog gets a new best friend. You're a real loser when your dog gets a new best friend+ You're never a loser until you quit trying. You're never alone with schizophrenia You're not drunk if you can lie on the floor without holding on. You're old when you forget how to start your rocking chair. You're only young once. You're immature forever. You're so vain, I bet you think this tagline's about you. You're twisted and sick; I like that in a person! You've been smoking that stuff again, uh? You've got to hand it to the IRS. If not, they'll come and take it. You've got to have an ace in the hole. You've reached middle age when all you exercise is caution. Young flesh and old fish are best. Your choice about Jesus affects all other choices. Your E-Mail has been returned due to insufficient voltage Your e-mail has been returned due to insufficient voltage. Your ex just called. She's with the IRS now. Your home, and indeed some Cadillacs, have more computing power than many third-world nations. -- Daniel Siewiorek. Your lucky star imploded into a black hole. - Ziggy "Your move." -Colossus Your program is sick! Shoot it and put it out of its memory. Your resume will be used on the "Tonight Show" monologue. Your tagline has been assimilated. - BorgReader Youth isn't a time of life but a state of mind. Zaphod Beeblebrox for Prime Minister! Zeal without knowledge is fire without light. Zen congressmen pass transcendental legislation. Zen Druidry: transcendental vegetation. Zen Druids practice Transcendental Vegetation. Zzzzz ... This Tagline is taking a nap ... zzzzz |||||||//////__ __ __ __ __ The domino effect at work. h C*hanks for hanging up, dear.